摘要
In vitro transcription-translation, Gene mutation, Polymerase claim reaction, Hemophilia B, SDS-PAGE, pH gradient gel focusing
A new method for screening gene mutations by using a Coupled In Vitro Transcription and Translation System is reported in this paper. It includes the following steps: (1) The target DNA fragments with T7T1 sequence at its 5 prime end are amplified (T7T1: GGATCCTAATACGACTCTATAGGGAG ACCACCATG); (2) The RNA and peptide are synthesized and labeled from the PCR product in the coupled In Vitro Transcription-Translation System; (3) The produced peptides are analyzed by using SDS-PAGE and pH Gradient gel focusing electrophoresis. Four peptide products from 4 HB patients with nonsense mutation in Exon H of F IX gene show truncated protein bands with speeded migration in the autoradiography of the SDS-PAGE. Ten out of 11 HB patients with different missense mutations show abnormal patterns in the autoradiography of a pH 4-7 gradient gel focusing electrophoresis. Conclusion: The PCR and the Coupled In Vitro Transcription-Translation System/SDS-PAGE is a good method for proteins truncation test. The PCR and the Transcription-Translation System combined with pH gradient gel focusing electrophoresis is an efficient method for screening the abnormal protein products from DNA fragments with missense mutations.