Hypoparathyroidism with situs inversus totalis:A case report

BACKGROUND Hypoparathyroidism(HP)is a rare endocrine disorder,while situs inversus totalis(SIT)is a rare condition in which the internal organs are positioned in a mirrored pattern compared to their usual positions.This case illustrates some potential shared mechanisms between HP and SIT,highlighting the importance of accurate identification and prompt first emergency,offering insights for future research.CASE SUMMARY This report discusses a case of a middle-aged patient with adolescent-onset HP with concurrent SIT.The patient experienced recurrent episodes of increased neuromuscular excitability(manifesting as spasms in the hands and feet and laryngospasms)and even periods of unconsciousness.Initially,these symptoms led to a misdiagnosis of epilepsy.Nevertheless,upon thorough examination and treatment in the general medicine ward,the correct diagnosis was established.Corresponding treatment resulted in improved management of the patient’s symptoms.CONCLUSION Co-occurrence of HP and SIT may be associated with genetic mutations,chromosomal anomalies,or hereditary factors,as may other similar conditions.

Laparoscopic common bile duct exploration to treat choledocholithiasis in situs inversus patients:A technical review

Situs inversus(SI)is a rare congenital condition characterized by a mirror-image transposition of the major visceral organs.Since the 1990s,more than one hundred SI patients have been reported to have successfully undergone laparoscopic cholecystectomy.In these cases,the major problem is to overcome is the left-right condition for right-handed surgeons.Laparoscopic common bile duct exploration(LCBDE),an alternative to treat patients with bile duct stones,has shown equivalent efficacy and is less likely to cause pancreatitis than endoscopic retrograde cholangiopancreatography.Recent updated meta-analyses revealed that a shorter postoperative hospital stay,fewer procedural interventions,cost-effectiveness,a higher stone clearance rate,and fewer perioperative complications are additional advantages of LCBDE.However,the technique is technically demanding,even for skilled laparoscopic surgeons.Conducting LCBDE in patients with difficult situations,such as SI,is more complex than usual.We herein review published SI patients with choledocholithiasis treated by LCBDE,including our own experience,and this paper focuses on the technical aspects.

Identification and functional analyses of a novel FOXL2 pathogenic variant causing blepharophimosis, ptosis, and epicanthus inversus syndrome

AIM: To discover the molecular pathogenic basis of the blepharophimosis, ptosis, and epicanthus inversus syndrome(BPES), and to predict the clinical subtype according to in vitro experiments, which is significant to the prognosis.METHODS: A 3-year-old sporadic female patient with typical clinical manifestations of BPES was enrolled. The coding region of forkhead box L2(FOXL2) gene was sequenced, and the functional assays were performed in vitro by Western blotting, subcellular localization experiment, luciferase reporter assay, and quantitative realtime polymerase chain reaction.RESULTS: A novel FOXL2 point pathogenic variant(c.274G>T) was detected, resulting in a truncated protein(p.E92*). Functional studies demonstrated that the FOXL2 pathogenic variant induced the subcellular mislocalization and the abnormal transcriptional activity on promoters of the steroidogenic acute regulatory protein(StAR or STARD1) gene and the odd-skipped related 2 transcription factor(OSR2) gene.CONCLUSION: A novel pathogenic variant is identified to expand the spectrum of the known FOXL2 mutations. The in vitro experiments provide reference data and more insights to the molecular pathogenesis of BPES. The predicted high risk of ovarian insufficiency makes it significant for the patient enrolled to have further follow-up and therapy concerning female endocrinology.

Laparoscopy-assisted gastrectomy for advanced gastric cancer patients with situs inversus totalis: Two case reports and review of literature

BACKGROUND Situs inversus totalis(SIT)is a rare condition in which the positions of abdominal and thoracic organs present a“mirror image”of the normal ones in the median sagittal plane.Although minimally invasive surgery has evolved to achieve laparoscopic gastrectomy for gastric cancer(GC)patients with SIT,it is difficult to perform lymphadenectomy(LND)in such a transposed anatomical condition.Herein,we report the cases of two patients with SIT who successfully underwent laparoscopy-assisted gastrectomy(LAG)with D2 LND.CASE SUMMARY Case 1:A 65-year-old man was admitted for intermittent abdominal pain and distension,occasional belching,and acid reflux for 4 mo.He was diagnosed with GC(cT3N1-2M0)with SIT.Before surgery,he had undergone four cycles of neoadjuvant chemotherapy and immunotherapy.Then,the patient was evaluated as having a partial response,and laparoscopy-assisted distal gastrectomy with D2 LND and Billroth II reconstruction were performed.The operation was performed successfully within 240 min with an estimated blood loss of 50 mL and no severe complications.The patient was discharged on postoperative day(POD)9.Case 2:A 55-year-old man was admitted for upper abdominal distension with pain and discomfort after eating for 3 mo.He was diagnosed with GC(cT3N1M0)with SIT.He had a history of hypertension for more than 10 years;however,his blood pressure was well-controlled via regular medication.We performed laparoscopy-assisted total gastrectomy with D2 LND and Roux-en-Y reconstruction.The operation was performed successfully within 168 min with an estimated blood loss of 50 mL and no severe complications.The patient was discharged on POD 10.CONCLUSION LAG with D2 LND could be considered an accessible,safe,and curative procedure for advanced GC patients with SIT.

Situs inversus totalis in an asymptomatic adolescent-importance of patient education:A case report

BACKGROUND Situs inversus totalis(SIT)may be an incidental finding in asymptomatic children.Patients may not understand the implications of this condition and the importance of relaying the diagnosis to their healthcare providers.CASE SUMMARY We report an asymptomatic seventeen-year-old adolescent with previouslydiagnosed SIT who presented for a routine well-child visit.During history taking,he denied any past medical conditions,including cardiovascular conditions.Only when physical exam revealed point of maximal impulse and heart sounds on the right side,did he convey that he had been diagnosed with SIT incidentally at age of 12 years.He was not aware of associated conditions or the potential implications of his diagnosis,nor did he realize it is pertinent medical history to be relayed to healthcare providers.Chest X-ray confirmed dextrocardia and abdominal X-ray showed right-sided stomach.Abdomen sonogram showed left-sided liver and right-sided spleen.Echocardiogram showed normal valvular structure and function.A comprehensive discussion was provided to address the patient’s lack of understanding that SIT is a medical diagnosis with potential implications.CONCLUSION While SIT is rare and mostly asymptomatic,affected patients may not comprehend the importance of the diagnosis and its potential ramifications.Recognition of the patient’s lack of awareness allows the healthcare provider to educate the patient and hopefully can prevent potential medical and surgical complications.

Laparoscopic hemicolectomy in a patient with situs inversustotalis

As among persons with normal anatomy, occasional patients with situs inversus develop malignant tumors. Recently, several laparoscopic operations have been reported in patients with situs inversus. We describe laparoscopic hemicolectomy with radical lymphadenectomy in such a patient. Careful consideration of the mirror-image anatomy permitted safe operation using techniques not otherwise differing from those in ordinary cases. Thus, curative laparoscopic surgery for colon cancer in the presence of situs inversus is feasible and safe.

Laparoscopic cholecystectomy in situs inversus totalis with “inferior” cystic artery: A case report

A 76-year-old man with known situs inversus totalis presented with leE-sided discomfort. Abdominal ultrasonography and CT scan confirmed the diagnosis of a gallstone, as well as, situs inversus; the liver and gallbladder on the left side and the spleen on the right. The biliary system was thought to be left-right reversal, mirror image in the view of drip infusion cholangiogram and MRI. Laparoscopic cholecy stectomy was safely performed, despite of unexpected aberrant cystic artery running inferior to cystic duct of situs inversus. Laparoscopic surgeon should be careful for view of reversed relationships and also existence of other anomalies.

Therapeutic endoscopic retrograde cholangiopancreatography in a patient with situs inversus viscerum

Situs inversus viscerum(SIV)is a rare congenitalcondition characterized by complete transposition of all viscera.This anatomical pathology makes endoscopic retrograde cholangiopancreatography(ERCP)technically difficult.We report a new case of a 70-year-old Chinese male with total SIV who had obstructive jaundice.Magneticresonance cholangiopancreatography demonstrated a number of stones in the gallbladder and common bile duct(CBD).Therapeutic ERCP was performed to relieve biliary obstruction and remove the CBD stones.This procedure started with the patient in a supine position and the endoscopist at the left side of the table.When the papilla was maintained,the patient was repositioned to a prone position and standard endoscopic sphincterotomy and endoscopic papillary balloon dilatation procedures were conducted.ERCP was performed successfully and relevant complications did not occur in this patient.We also present a review of the literature published between 1985 and 2014in the Pub Med and EMBASE databases.There were eight published cases during this period,with one each from America,Finland,India,Italy,South Korea and Pakistan,and two from Spain.Our case is the first reported in China.

Laparoscopy-assisted resection of colorectal cancer with situs inversus totalis: A case report and literature review

BACKGROUND Situs inversus totalis(SIT)is a rare anomaly in which structures are located opposite to their usual positions.It is not a premalignant condition and the association with colorectal cancer(CRC)is rare.We here report a patient with SIT who underwent laparoscopic radical resection of sigmoid colon cancer,and review the pertinent literature.CASE SUMMARY A 53-year-old woman presented with CRC and SIT and underwent a complete examination after admission.The patient then underwent laparoscopic radical resection of sigmoid colon cancer and hyperthermic intraperitoneal chemotherapy.The operation duration was 120 min,and no intraoperative complications occurred.The final pathological report showed stage T4aN0M0.Postoperative chemotherapy was administered and no evidence of recurrence was observed during 18 mo of follow-up.CONCLUSION Surgery in a patient with CRC and SIT can be safely performed on the basis of routine preoperative clinical examination.

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome

AIM:To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosisptosis-epicanthus inversus syndrome(BPES).METHODS:Thirteen patients with BPES and eight healthy family members were included in this study.All participants received routine ophthalmic examinations.The target next-generation sequencing(NGS)was performed to determine the causative mutation for this family.The silico analysis was also applied to predict the pathogenesis of identified mutations.RESULTS:All patients had severe ptosis,normal intelligence,female patients have normal fertility.Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene,c.672_701 ins GCGGCTGCCGC CGCAGCTGCTG CAGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA),carried by 13 patient but absent in all unaffected members.In silico analysis supported the pathogenic nature of this highly conserved variant.This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain,which increased the number of original polyalanine chains from 14 to 24,resulting in an extended protein.CONCLUSION:A novel FOXL2 mutation c.672_701 ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA)was identified in a large Chinese family with BPES.This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotypecorrelations,which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

Laparoscopic cholecystectomy in a patient with situs inversus totalis

Currently, laparoscopic cholecystectomy is an undoubtfully optimal treatment of cholelithiasis. What about performing this procedure on a patient with situs inversus totalis and what are the difficulties of this operation for a right-handed surgeon? We presented a 35-year-old man with unknown situs inversus totalis who was admitted with epigastric pain and digestive problems. Ultrasonography and computed tomography of the abdomen confirmed the diagnosis of a gallstone. Besides, the liver and gallbladder were on the left side and the spleen was on the right. All systems were left-right reversal as mirror image in all diagnostic studies. Laparoscopic cholecystectomy was safely performed, despite of difficulties of situs inversus. The patient was discharged on postoperative day 1. It should be considered that existence of other anomalies may easily cause uninvited injuries. In the patients with situs inversus, laparoscopic cholecystectomy can be safely managed by an experienced surgeon through laparoscopy, and also hepatobiliary surgery.

Thoracoscopic segmentectomy assisted by three-dimensional computed tomography bronchography and angiography for lung cancer in a patient living with situs inversus totalis: A case report

BACKGROUND Situs inversus totalis(SIT)is a rare congenital condition that is characterized by a complete mirror image of the typical arrangement of the thoracic and abdominal viscera.Performing thoracoscopic segmentectomy for a patient with lung cancer and SIT is an extremely skilled and challenging surgical procedure.CASE SUMMARY A 41-year old woman with a medical history of dextrocardia since childhood was admitted to our hospital with a mixed ground-glass opacity(mGGO)in her left lung field,discovered by computed tomography during her health checkup.In order to facilitate surgical orientation,three-dimensional computed tomography bronchography and angiography(3D-CTBA)was preoperatively carried out.The result of 3D-CTBA was consistent with the diagnosis of SIT and an mGGO in the posterior segment of the left upper lobe(LS2).Surgery was conducted in accordance with preoperative 3D-CTBA and designed surgical procedure,combined with intraoperative navigation.Final pathological examination revealed in situ adenocarcinoma.The patient’s postoperative condition was uneventful and no complications were observed.CONCLUSION We present the first case of lung cancer in a patient with SIT who successfully underwent thoracoscopic segmentectomy assisted by 3D-CTBA.This is a new technique that covers precise confirmation and dissection of targeted structures and intersegmental demarcation,and can help achieve a meticulous anatomical segmentectomy.

Using Materialise’s interactive medical image control system to reconstruct a model of a patient with rectal cancer and situs inversus totalis: A case report

BACKGROUND Situs inversus totalis(SIT)is a rare congenital anomaly that refers to a completely reversed location of abdominal and thoracic organs.An extremely small number of patients with this condition,especially those with rectal neoplasms,have been reported.Surgery in these patients is technically challenging.Therefore,we reconstructed a three-dimensional(3D)digital model with the Materialise’s interactive medical image control system(Mimics)as a guide for laparoscopic resection.CASE SUMMARY We report the case of a 68-year-old woman with rectal neoplasms and SIT diagnosed by electronic colonoscopy biopsy and enhanced computed tomography(CT),which showed that there was a soft tissue mass protruding into the lumen in the lower rectal segment,a lesion that involved the serosal layer,multiple enlarged peripheral lymph nodes,and visceral situs abnormalities.Based on the CT images,we reconstructed a 3D model with Mimics to assist with our surgical planning.Then,we performed laparoscopyassisted radical resection of the rectal neoplasms and total excision of the lesion.Adjuvant chemotherapy with the XELOX regimen(oxaliplatin 150 mg,D1+Xeloda 1.0 g,Bid,D1-14)was initiated 1 mo after the operation.The patient recovered well after surgery,and her physical condition remained stable.CONCLUSION Preoperative 3D reconstruction of the imaging results could help reduce the unknown risks during surgery caused by anatomical abnormalities and improvethe perioperative safety for patients.

Situs inversus abdominus and malrotation in an adult with Ladd's band formation leading to intestinal ischaemia

Situs inversus abdominus with rotational anomaly of the intestines is an extremely rare condition. Although intestinal malrotation has been recognized as a cause of obstruction in infants and children and may be complicated by intestinal ischaemia, it is very rare in adults. When it occurs in the adult patient, it may present acutely as bowel obstruction or intestinal ischaemia or chronically as vague intermittent abdominal pain. Herein, we present an acute presentation of a case of situs inversus abdominus and intestinal malrotation with Ladd＇s band leading to infarction of the intestine in a 32 year old woman.

Da Vinci robot-assisted pancreato-duodenectomy in a patient with situs inversus totalis:A case report and review of literature

BACKGROUND Situs inversus totalis(SIT)is an extremely rare congenital malformation characterized by mirror displacement of the thoracoabdominal organs such as the heart,liver,spleen,and stomach.Herein,we describe a patient with SIT complicated with cholangiocarcinoma who underwent successful pancreaticoduodenectomy with the assistance of a da Vinci robot.CASE SUMMARY A 58-year-old female presented to the hospital with paroxysmal pain in her left upper abdomen,accompanied by jaundice and staining of the sclera as chief complaints.Imaging examination detected a mass at the distal end of the common bile duct,with inverted thoracic and abdominal organs.Endoscopic retrograde cholangiopancreatography forceps biopsy revealed the presence of a well-differentiated adenocarcinoma.The patient successfully underwent robotic-assisted pancreaticoduodenectomy;the operation lasted 300 min,the intraoperative blood loss was 500 mL,and there were no intraoperative and postoperative complications.CONCLUSION SIT is not directly related to the formation of cholangiocarcinoma.Detailed preoperative imaging examination is conducive to disease diagnosis and also convenient for determining the feasibility of tumor resection.Robot-assisted pancreaticoduodenectomy for SIT complicated with cholangiocarcinoma provides a safe,feasible,minimally invasive,and complication-free alternative with adequate preoperative planning combined with meticulous intraoperative procedures.

Hepatocellular Carcinoma with Hypersplenic Thrombocytopenia and Situs Inversus Totalis:A Case Report

SITUS inversus totalis （SIT） is a complete mirrorimage of the thoracic and abdominal viscera,occurring at an incidence of 1 in 5000-20 000live births.1, 2 It is supposed to originate from anabnormal rotation of the cardiac tube during embryogenesis.Although SIT is a congenital anomaly, most of patients aredetected accidentally at the time of radiological investigation.Hepatocellular carcinoma （HCC） is usually associated withliver cirrhosis and portal hypertension in Chinese. Presenceof hypersplenic thrombocytopenia is a common consequenceof long-term portal hypertension in cirrhoticpatients.

Laparoscopy-assisted distal gastrectomy for advanced gastric cancer with situs inversus totalis:A case report

Situs inversus totalis(SIT) is a rare anomaly in which the abdominal and thoracic cavity structures are located opposite to their usual positions. Occasionally,patients with this condition are diagnosed with malignant tumors. We report a case of a 60-yearold woman with gastric cancer and SIT. Laparoscopyassisted distal gastrectomy(LADG) with D2 lymph node dissection and Billroth Ⅱ anastomosis were performed successfully on the patient by careful consideration of the mirror-image anatomy. The operation required 230 min, and no intraoperative complications occurred. The final pathological report was p T4 a N0M0,according to the American Joint Committee on Cancer 7th edition staging guidelines. The postoperative course was favorable, and the patient was discharged on postoperative day 8. We believe that this is the first case of LADG with D2 lymphadenectomy reported in a SIT patient with advanced gastric cancer.

Laparoscopic hemicolectomy in a patient with situs inversus totalis after open distal gastrectomy

Situs inversus totalis(SIT) is a rare anomaly in which the abdominal and thoracic cavity structures are opposite their usual positions.Occasionally,a few patients with a combination of this condition and malignant tumors have been encountered.Recently,several laparoscopic operations have been reported in patients with SIT.We report a case of an 83-year-old man with situs inversus totalis who developed colon cancer after open distal gastrectomy.Laparoscopic hemicolectomy with radical lymphadenectomy in such a patient was successfully performed by careful consideration of the mirror-image anatomy.Techniques themselves was not different from those in ordinary cases.Thus,curative laparoscopic surgery for colon cancer in the presence of situs inversus totalis is feasible and safe.

Congenital tuberculosis with tuberculous meningitis and situs inversus totalis:A case report

BACKGROUND Congenital tuberculosis(TB),tuberculous meningitis,and situs inversus totalis are rare diseases.We here report a patient who simultaneously suffered from these three rare diseases.There is currently no such report in the literature.Congenital TB is easily misdiagnosed and has a high case fatality rate.Timely anti-TB treatment is required.CASE SUMMARY A 19-day-old male newborn was admitted to hospital due to a fever for 6 h.His blood tests and chest X-rays suggested infection,and he was initially considered to have neonatal pneumonia and sepsis.He did not respond to conventional antiinfective treatment.Finally,Mycobacterium tuberculosis was found in sputum lavage fluid on the 10th day after admission.In addition,the mother's tuberculin skin test was positive,with an induration of 22 mm,and her pelvic computed tomography scan suggested the possibility of tuberculous pelvic inflammatory disease.The child was diagnosed with congenital TB and immediately managed with anti-TB therapy and symptomatic supportive treatment.However,the infant's condition gradually worsened and he developed severe tuberculous pneumonia and tuberculous meningitis,and eventually died of respiratory failure.CONCLUSION If conventional anti-infective treatment is ineffective in neonatal pneumonia,anti-TB treatment should be considered.

Ascending colon cancer and situs inversus totalis-altered surgeon position for successful laparoscopic hemicolectomy: A case report

BACKGROUND Situs inversus totalis(SIT)is a rare congenital condition in which the structure of the abdominal and thoracic cavities is the mirror image of normal.This anatomic reversal makes laparoscopic surgery difficult when treating colorectal cancer.CASE SUMMARY We describe the successful laparoscopic hemicolectomy of a 68-year-old Chinese woman with SIT and ascending colon cancer.Based on preoperative imaging and careful consideration of the patient’s anatomy,the position of the surgeon was modified such that the surgeon stood between her legs,while the surgical assistant and endoscopist stood to the surgeon’s left.Trocar position was also adjusted appropriately.The surgery lasted 178 min,during which the patient lost 50 mL of blood.Pathology analysis of the resected tumor confirmed an adenocarcinoma in clinical stage pT3N0M0,without lymph node involvement.The patient experienced no postoperative complications and was discharged 10 d after surgery.CONCLUSION This case illustrates that careful positioning of the surgeon can facilitate laparoscopic surgery of SIT patients.