A novel detection of single-stranded DNA binding protein based on ss-DNA modified chip using surface plasmon resonance microscopy

An ss-DNA gold chip was prepared based on self-assembly of the thiol-derivatized oligonucleotide, and used for the determination of single-stranded binding protein （SSB） by surface plasmon resonance microscopy （SPR）. The experiment results showed that SSB binds ss-DNA with high specificity, and relative signal of SPR response is proportional to the concentration of SSB in the range of 0.1-100 ng/mL with a detection limit （S/N = 3） of 0.07 ng/mL.

A circular single-stranded DNA mycovirus infects plants and confers broad-spectrum fungal resistance

Circular single-stranded DNA(ssDNA)viruses have been rarely found in fungi,and the evolutionary and ecological relationships among ssDNA viruses infecting fungi and other organisms remain unclear.In this study,a novel circular ssDNA virus,tentatively named Diaporthe sojae circular DNA virus 1(DsCDV1),was identified in the phytopathogenic fungus Diaporthe sojae isolated from pear trees.DsCDV1 has a monopartite genome(3185 nt in size)encapsidated in isometric virions(21-26 nm in diameter).The genome comprises seven putative open reading frames encoding a discrete replicase(Rep)split by an intergenic region,a putative capsid protein(CP),several proteins of unknown function(P1-P4),and a long intergenic region.Notably,the two split parts of DsCDV1 Rep share high identities with the Reps of Geminiviridae and Genomoviridae,respectively,indicating an evolutionary linkage with both families.Phylogenetic analysis based on Rep or CP sequences placed DsCDV1 in a unique cluster,supporting the establishment of a new family,tentatively named Gegemycoviridae,intermediate to both families.DsCDV1 significantly attenuates fungal growth and nearly erases fungal virulence when transfected into the host fungus.Remarkably,DsCDV1 can systematically infect tobacco and pear seedlings,providing broad-spectrum resistance to fungal diseases.Subcellular localization analysis revealed that DsCDV1 P3 is systematically localized in the plasmodesmata,while its expression in trans-complementation experiments could restore systematic infection of a movement-deficient plant virus,suggesting that P3 is a movement protein.DsCDV1 exhibits unique molecular and biological traits not observed in other ssDNA viruses,serving as a link between fungal and plant ssDNA viruses and presenting an evolutionary connection between ssDNA viruses and fungi.These findings contribute to expanding our understanding of ssDNA virus diversity and evolution,offering potential biocontrol applications for managing crucial plant diseases.

Single-stranded RNA as primers of terminal deoxynucleotidyl transferase for template-independent DNA polymerization

Terminal deoxynucleotidyl transferase(Td T) has been characterized as template-independent polymerase using single-stranded DNA(ss DNA) as primers to generate random oligonucleotides. However, the extension performance of Td T to single-stranded RNA(ss RNA) is vague. By systematically comparing and contrasting the performance of Td T-catalyzed ss DNA and ss RNA extension, it is indicated that the catalytic efficiency of ss RNA as primers was about 3 times lower than ss DNA as primers. Collectively, it is believed that understanding the catalytic performance of Td T will help to design the strategy to synthesize chimeric DNA on 3-OH of ss RNA, which becomes invaluable.

Plant and animal positive-sense single-stranded RNA viruses encode small proteins important for viral infection in their negative-sense strand

Positive-sense single-stranded RNA(+ssRNA)viruses,the most abundant viruses of eukaryotes in nature,require the synthesis of negative-sense RNA(-RNA)using their genomic(positive-sense)RNA(+RNA)as a template for replication.Based on current evidence,viral proteins are translated via viral+RNAs,whereas-RNA is considered to be a viral replication intermediate without coding capacity.Here,we report that plant and animal+ssRNA viruses contain small open reading frames(ORFs)in their-RNA(reverse ORFs[rORFs]).Using turnip mosaic virus(TuMV)as a model for plant+ssRNA viruses,we demonstrate that small proteins encoded by rORFs display specific subcellularlocalizations,and confirm the presence of rORF2 in infected cells through mass spectrometry analysis.The protein encoded by TuMV rORF2 forms punctuate granules that are localized in the perinuclear region and co-localized with viral replication complexes.The rORF2 protein can directly interact with the viral RNA-dependent RNA polymerase,and mutation of rORF2 completely abolishes virus infection,whereas ectopic expression of rORF2 rescues the mutant virus.Furthermore,we show that several rORFs in the-RNA of severe acute respiratory syndrome coronavirus 2(SARS-CoV-2)have the ability to suppress type l interferon production and facilitate the infection of ve-sicular stomatitis virus.In addition,we provide evidence that TuMV might utilize internal ribosome entry sites to translate these small rORFs.Taken together,these findings indicate that the-RNA of+ssRNA vi-ruses can also have the coding capacity and that small proteins encoded therein play critical roles in viral infection,revealing a viral proteome larger than previously thought.

Orthogonal assays for the identification of inhibitors of the single-stranded nucleic acid binding protein YB-1

We have previously shown that high expression of the nucleic acid binding factor YB-1 is strongly associated with poor prognosis in a variety of cancer types. The 3-dimensional protein structure of YB-1 has yet to be determined and its role in transcriptional regulation remains elusive. Drug targeting of transcription factors is often thought to be difficult and there are very few published high-throughput screening approaches. YB-1 predominantly binds to single-stranded nucleic acids, adding further difficulty to drug discovery. Therefore, we have developed two novel screening assays to detect compounds that interfere with the transcriptional activation properties of YB-1, both of which may be generalizable to screen for inhibitors of other nucleic acid binding molecules. The first approach is a cell-based luciferase reporter gene assay that measures the level of activation of a fragment of the E2 F1 promoter by YB-1. The second approach is a novel application of the Alpha Screen system, to detect interference of YB-1 interaction with a single-stranded DNA binding site. These complementary assays examine YB-1 binding to two discrete nucleic acid sequences using two different luminescent signal outputs and were employed sequentially to screen 7360 small molecule compounds leading to the identification of three putative YB-1 inhibitors.

Optimization of PCR Reaction System for Random Single-strand DNA Pool in SELEX Technology

[Objective] This study aimed to optimize the PCR amplification conditions for random ssDNA pool in SELEX technology. [Method] L16（45） orthogonal experimental design was adopted for optimization of five important factors affecting PCR reaction system for random single-stranded DNA pool including Mg2＋ concentration, dNTP concentration, amount of Taq DNA polymerase, primer concentration and amount of random single-stranded DNA pool at four levels. Meanwhile, the annealing temperature and number of PCR reaction cycles were optimized to establish the optimal reaction system and PCR procedure. [Result] The optimal combination of PCR reaction system for random ssDNA pool was obtained, with a total system volume of 20 μl containing 2.0 μl of 10 × Buffer, 0.5 ng of random ssDNA pool, 2.5 mmol/L Mg2＋, 0.25 mmol/L dNTP Mixture, 0.6 μmol/L upstream and downstream primers and 1.5 U of Taq DNA polymerase; the optimal annealing temperature was 68 ℃ and the optimal number of cycles was 12. Under the above conditions, clear and stable bands with high specificity for random ssDNA pool were amplified. [Conclusion] This study laid the foundation for selection of parameters with higher specificity in SELEX technology.

XRCC1 and DNA polymerase β in cellular protection against cytotoxic DNA single-strand breaks

Single-strand breaks （SSBs） can occur in cells either directly, or indirectly following initiation of base excision repair （BER）. SSBs generally have blocked termini lacking the conventional 5＇-phosphate and 3＇-hydroxyl groups and require further processing prior to DNA synthesis and ligation. XRCC1 is devoid of any known enzymatic activity, but it can physically interact with other proteins involved in all stages of the overlapping SSB repair and BER pathways, including those that conduct the rate-limiting end-tailoring, and in many cases can stimulate their enzymatic activities. XRCC1^-/- mouse fibroblasts are most hypersensitive to agents that produce DNA lesions repaired by monofunctional glycosylase-initiated BER and that result in formation of indirect SSBs. A requirement for the deoxyribose phosphate lyase activity of DNA polymerase β （pol β） is specific to this pathway, whereas pol β is implicated in gap-filling during repair of many types of SSBs. Elevated levels of strand breaks, and diminished repair, have been demonstrated in MMS- treated XRCC1^-/-, and to a lesser extent in pol β^-/- cell lines, compared with wild-type cells. Thus a strong correlation is observed between cellular sensitivity to MMS and the ability of cells to repair MMS-induced damage. Exposure of wild-type and polβ^-/- cells to an inhibitor of PARP activity dramatically potentiates MMS-induced cytotoxicity. XRCC1^-/- cells are also sensitized by PARP inhibition demonstrating that PARP-mediated poly（ADP-ribosyl）ation plays a role in modulation of cytotoxicity beyond recruitment of XRCC 1 to sites of DNA damage.

Affinity and fluorescent detection of surfactants/ssDNA and single-walled carbon nanotube

A new biosensor platform was explored for detection of surfactant based on fluorescence changes from single strand DNA （ssDNA） and single-walled carbon nanotubes （SWNTs）. Thermodynamics assay was performed to value the stability of probe. The affinities of SWNT to five common surfactants （SDS, DBS, Triton X-100, Tween-20 and Tween-80） were investigated by real-time fluorescence method. The effects of Mg^2＋ and pH on the fluorescence intensity of self-assembled quenched sensor were performed. The fluorescent emission spectra were used to measure the responses of self-assembled quenched fluorescent of ssDNA/SWNTs to different concentration surfactant（Triton X-100）. The FAM-DNA wrapped SWNTs probe was stable in a wide temperature range （5 ℃ to 80℃）. The binding strength of surfactants and single-stranded DNA （ssDNA） on SWNTs surfaces was shown as follows： Triton X-100〉DBS〉Tween-20〉Tween-80〉ssDNA〉SDS, and the optimized reaction conditions included pH 7.4 and 10 mmol/L Mg2＋. The fluorescence of FAM-ssDNA wrapped SWNTs was proportionally recovered as a result of adding different concentrations of Triton X- 100, which realizes the quantitative detection of Triton X- 100.

Adsorption and desorption behaviors of ssDNA molecules on mica surface by surface forces apparatus

An approach for studying the adsorption and desorption behaviors of single-stranded DNA（ ssDNA） molecules on the mica surface by the surface forces apparatus（ SFA） is reported,which can be used to characterize the precise thickness,configuration and mechanical properties of ssDNA layers on the mica surface at a certain buffer solution. The formation of ss DNA layers is first studied by tuning the ssDNA concentrations, and the experimental results indicate that the ss DNA concentration of 100 ng / μL is ideal for forming a ssDNA monolayer structure on the mica surface, and the hardwall value measured to be 1.04 nm under this circumstance is regarded as the thickness of the ssDNA monolayer confined on mica. The desorption behavior of ssDNA molecules from the mica surface is further studied by observing and comparing different shapes of the force-distance curves under certain conditions. It is found that the desorption of ss DNA molecules from the mica surface occurs as the monovalent salts are added into the gap buffer. It is inferred that the competition effect between monovalent and divalent salts can induce the release of ssDNA from substrate.The results also reveal that 10 mmol / L monovalent salts（ Na~＋）is sufficient for the desorption of ssDNA from mica. This work provides an applicable method to study the binding mechanism of ss DNA molecules on inorganic substrates.

Virulence and potential pathogenicity of coccoid Helicobacter pylori induced by antibiotics

AIM: To explore the virulence and the potential pathogenicity of coccoid Helicobacter pylori (H. pylori) transformed from spiral form by exposure to antibiotic. METHODS: Three strains of H. pylori, isolated from gastric biopsy specimens of confirmed peptic ulcer, were converted from spiral into coccoid from by exposure to metronidazole. Both spiral and coccoid form of H. pylori were tested for the urease activity, the adherence to Hep-2 cells and the vacuolating cytotoxicity to Hela cells, and the differences of the protein were analysed by SDS-PAGE and Western blot. The mutation of the genes including ureA, ureB,hpaA, vacA and cagA, related with virulence, was detected by means of PCR and PCR-SSCP. RESULTS: In the coccoid H. pylori,the urease activity, the adherence to Hep-2 cells and the vacuolating cytotoxicity to Hela cells all decreased. In strain F44, the rate and index of adherence reduced from 70.0% +/- 5.3% to 33% +/- 5.1% and from 2.6 +/- 0.4 to 0.96 +/- 0.3 (P 【 0.01), respectively. The invasion of coccoid H. pylori into Hep-2 cell could be seen under electronmicroscope. SDS-PAGE showed that the content of the protein with the molecular weight over Mr 74000 decreased, and the hybriditional signal in band M(r) 125000 weakened, while the band M(r)110000 and M(r)63000 strengthened in coccoid H.pylori as shown in Western blot. The results of PCR were all positive, and PCR-SSCP indicated that there may exist the point mutation in gene hpaA or vacA. CONCLUSION: The virulence and the proteins with molecular weight over M(r)74000 in coccoid H.pylori decrease, but no deletion exists in amplification fragments from ureA, ureB, hpaA, vacA and cagA genes, suggesting that coccoid H.pylori may have potential pathogenicity.

The point mutation of p53 gene exon7 in hepatocellular carcinoma from Anhui Province,a non HCC prevalent area in China

AIM: In hepatocellular carcinoma (HCC) prevalent areas of China, the point mutation of p53 exon7 is highly correlated with Hepatitis B virus(HBV) infection and aflatoxin B intake. While in non-HCC-prevalent areas of China, these factors are not so important in the etiology of HCC. Therefore, the point mutation of p53 exon7 may also be different than that in HCC-prevalent areas of China. The aim of this study is to investigate the status and carcinogenic role of the point mutation of p53 gene exon7 in hepatocellular carcinoma from Anhui Province, a non-HCC-prevalent area in China. METHODS: PCR PCR-SSCP and PCR-RFLP were applied to analyze the homozygous deletion and point mutation of p53 exon7 in HCC samples from Anhui, which were confirmed by DNA sequencing and Genbank comparison. RESULTS: In the 38 samples of hepatocellular carcinoma, no homozygous deletion of p53 exon7 was detected and point mutations of p53 exon7 were found in 4 cases, which were found to be heterozygous mutation of codon 249 with a mutation rate of 10.53%(4/38). The third base mutation(G-T) of p53 codon 249 was found by DNA sequencing and Genbank comparison. CONCLUSION: The incidence of point mutation of p53 codon 249 is lower in hepatocellular carcinoma and the heterozygous mutation of p53 exon7 found in these patients only indicate that they have genetic susceptibility to HCC. p53 codon 249 is a hotspot of p53 exon7 point mutation, suggesting that the point mutation of p53 exon 7 may not play a major role in the carcinogenesis of HCC in Anhui Province, a non-HCC-prevalent area in China.

Peptide nucleic acid (PNA) binding-mediated gene regulation

Peptide nucleic acids (PNAs) are synthetic oligonucleotides with chemically modified backbones. PNAs can bind to both DNA and RNA targets in a sequence-specific manner to form PNA/DNA and PNA/RNA duplex structures. When bound to double-stranded DNA (dsDNA) targets, the PNA molecule replaces one DNA strand in the duplex by strand invasion to form a PNA/DNA/PNA [or (PNA)2/DNA] triplex structure and the displaced DNA strand exists as a singlestranded D-loop. PNA has been used in many studies as research tools for gene regulation and gene targeting. The Dloops generated from the PNA binding have also been demonstrated for its potential in initiating transcription and inducing gene expression. PNA provides a powerful tool to study the mechanism of transcription and an innovative strategy to regulate target gene expression. An understanding of the PNA-mediated gene regulation will have important clinical implications in treatment of many human diseases including genetic, cancerous, and age-related diseases.

Asymmetric PCR method in generation of HBV ssDNA for pyrosequencing

Objective To explore the optimal primer ratio and concentration of asymmetric polymerase chain reaction (A-PCR) in producing hepatitis B virus (HBV) single-stranded DNA (ssDNA) for pyrosequencing. Methods A-PCR was carried out to generate HBV ssDNA with forward to reverse primers of different ratios (50∶1, 100∶1) and concentrations (13.0 pmol/25μL and 0.14 pmol/25μL, 19.5 pmol/25μL and 0.21 pmol/25μL), and the product yield and quality were compared respectively. Results The forward to reverse primer ratio of 50∶1 provided better yield and concentration of 19.5 pmol/25μL and 0.21 pmol//25μL generated a clearer band. Conclusion A simple and feasible method to produce HBV ssDNA for pyrosequencing in batch is established.

DETECTION OF STRAND BREAKS OF DNA IN HUMAN EARLY CHORIONIC VILLUS CELLS INDUCED BY DIAGNOSTIC ULTRASOUND USING ^(32)P-LABELED ALU HYBRIDIZATION

Objective To explore if strand breaks of DNA in human early chorionic villus cells in uterus were induced by diagnostic ultrasound and to evaluate the method used for detection of single-stranded breaks and double-stranded breaks in human DNA. Methods 60 normal pregnant women aged 20-30, who underwent artificial abortion during 6-8 weeks of gestation, were randomly divided into 2 experimental groups: All 30 cases were exposed to diagnostic ultrasound in uterus for 10 minutes, and 24 hours later chorionic villi were extracted; the other 30 cases were taken as the control group. Single-stranded DNA and double-stranded DNA in villus cells in all cases were isolated by the alkaline unwinding combined with hydroxylapatite chromatography, and were quantitatively detected using 32 P-labeled Alu probe for dot-blotting hybridization. Results There was no significant difference in quantity and percentage in single-stranded DNA and double-stranded DNA between 2 groups (P>0.05). 32 P-Alu probe could only hybridize with human DNA, and could detect DNA isolated from as few as 2.5×10 3 chorionic villus cells and 0.45ng DNA in human leukocytes. Conclusion The results suggested that there were no DNA strand damages in human chorionic villus cells when the uterus was exposed to diagnostic ultrasound for 10 minutes. The method,^(32)P-Alu probe for dot-blotting hybridization, was even more specific, sensitive and accurate than conventional approaches.

Cloning and Sequence Analysis of lef-3 Gene from Pieris rapae Granulovirus

To better understand the origination and evolution of lef-3 gene from baculovirus genome and determine the relationships between various viruses at molecular level, late expression factor 3 gene （lef-3） fragments of Pieris rapae granulovirus were obtained through conventional PCR method and sequenced after cloned into T-vector. Then, bioinformatics analysis on lef-3 gene and its encoding sequences were conducted by using bid-softs. Four mutations were appeared in the ORF of cloned lef-3 gene, which did not alter the characteristics of amino acids. It was inferred that PiraGV LEF-3 protein contained 399 amino acids, the molecular weight of which was 3.99 kD. Prediction of the LEF-3 advanced structure and homology comparison between other LEF-3 from various baculoviruses showed that the lef-3 gene might encode the single-stranded DNA-binding protein. The result of BLAST revealed that the lef-3 gene only existed in Lepidoptera host for the baculovirus genome, and the evolution analysis illustrated that lef-3 gene could be divided into 3 groups including one granulovirus （GV） group and 2 nucleopolyhedrovirus （NPV） groups. The selection pressure analysis of GV lef-3 gene coding region showed that the majority of lef-3 genes performed negative selection, while the Ka/Ks differed from different lef-3 gene, to some extent, which also performed positive selection. The origination analysis revealed that lef-3 gene of baculovirus might derive from bacteria. The lef-3 gene of PiraGV was cloned successfully and the possible patterns of origination and evolution were speculated through bioinformatics analysis.

Study on mitochondrial DNA diversity among 7 inbred strains of mice

Objective：To study the genetic variation of mitochondrial DNA （mtDNA） among common laboratory strains of inbred mice. Methods： The genetic polymorphism of mtDNA among 4 classical laboratory strains of inbred mice and 3 inbred strains of mice established in China was analyzed by polymerase chain reaction coupled with restriction fragment length polymorphism（PCR-RFLP） and PCR coupled with single-stranded conformation polymorphism（PCR-SSCP）. Results： With regard to the D-loop （Displacement loop, D-loop）, tRNA^ Met＋Glu＋Ile, and ND3 （NADH dehydrogenase subunit 3, ND3） gene fragments of mtDNA from these mice,no variation was revealed by PCR-RFLP at 46 restriction enzyme sites. Further analyzed by PCR-SSCP,the D-loop 5＇fragment and 3＇end fragment of mtDNA from these mice also showed no genetic variation. Conclusion： Owing to maternal mode of inheritance of mtDNA,the results indicate that these common inbred strains of mice share the same maternal lineage.

Detection of the polymorphism at codon 72 in exon 4 of p53 gene by PCR－SSCP

By employing different gel components and electrophoresis conditions, the PCR-SSCP(polymerase chain reaction-single-stranded conformation polymorphism) method was used to detect the polymorphism(CCC or CGC ) of codon 72 in exon 4 of p53 gene. The results

Aptamer-Based Extraction of Ergot Alkaloids from Ergot Contaminated Rye Feed

Ergot alkaloids are mycotoxins which can be found in food based on cereal-crops, due to a contamination of plants by fungi of the genus Claviceps. The ingestion of ergot contaminated cereal crops can lead to a severe poisoning known as ergotism. For food and feed safety purposes, the extraction of ergot alkaloids from ergot contaminated flour was investigated. For the specific recognition of ergot alkaloids, DNA aptamer ligands specially selected for ergot alkaloids were grafted onto silica gel in order to construct a specific solid phase extraction system. The aptamer-functionalized silica gels were used to extract ergot alkaloids from a contaminated rye feed sample. The presence of ergot alkaloids eluted from the aptamer-functionalized silica gels was analyzed using LC-QTOF-MS. By using this simple system, it was possible to specifically extract ergosine, ergokryptine and ergocornine from an ergot contaminated rye feed sample. This aptamer-based extraction tool shows the applicability of aptamers for the specific extraction of toxins or natural compounds from turbid matrices in a one-step procedure.

The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.

Evolution based on genome structure: the “diagonal genome universe”

The ratios of amino acid to the total amino acids and those of nucleotides to the total nucleotides in genes or genomes are suitable indexes to compare whole gene or genome characteristics based on the large number of nucleotides rather than their sequences. As these ratios are strictly calculated from nucleotide sequences, the values are independent of experimental errors. In the present mini-review, the following themes are approached according to the ratios of amino acids and nucleotides to their total numbers in the genome: prebiotic evolution, the chronological precedence of protein and codon formations, genome evolution, Chargaff’s second pa- rity rule, and the origins of life. Amino acid formation might have initially occurred during pre- biotic evolution, the “amino acid world”, and amino acid polymerization might chronologically precede codon formation at the end of prebiotic evolution. All nucleotide alterations occurred synchronously over the genome during biolo- gical evolution. After establishing primitive lives, all nucleotide alterations have been governed by linear formulae in nuclear and organelle genomes consisting of the double-stranded DNA. When the four nucleotide contents against each individual nucleotide content in organelles are expressed by four linear regression lines representing the diagonal lines of a 0.5 square – the “Diagonal Genome Universe”, evolution obeys Chargaff’s second parity rule. The fact that linear regression lines intersect at a single point su- ggests that all species originated from a single life source.