Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome

AIM:To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosisptosis-epicanthus inversus syndrome(BPES).METHODS:Thirteen patients with BPES and eight healthy family members were included in this study.All participants received routine ophthalmic examinations.The target next-generation sequencing(NGS)was performed to determine the causative mutation for this family.The silico analysis was also applied to predict the pathogenesis of identified mutations.RESULTS:All patients had severe ptosis,normal intelligence,female patients have normal fertility.Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene,c.672_701 ins GCGGCTGCCGC CGCAGCTGCTG CAGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA),carried by 13 patient but absent in all unaffected members.In silico analysis supported the pathogenic nature of this highly conserved variant.This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain,which increased the number of original polyalanine chains from 14 to 24,resulting in an extended protein.CONCLUSION:A novel FOXL2 mutation c.672_701 ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA)was identified in a large Chinese family with BPES.This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotypecorrelations,which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

Myopia with X-linked retinitis pigmentosa results from a novel gross deletion of RPGR gene

AIM: To identify mutations with whole exome sequencing(WES) in a Chinese X-linked retinitis pigmentosa(XLRP) family. METHODS: Patients received the comprehensive ophthalmic evaluation. Genomic DNA was extracted from peripheral blood and subjected to Sure Select Human All Exon 6+ UTR exon capture kit. The exons were sequenced as 100 base paired reads on Illumina HiS eq2500 system. Only mutations that resulted in a change in amino acid sequence were selected. A pattern of inheritance of the RP family was aligned to identified causal mutation.RESULTS: We analysed the data of WES information from XLRP family. The analysis revealed a hemizygous large genomic deletion of RPGR c.29113 del was responsible for this XLRP. The gross deletion lead to a frame-shift mutation and generate stop codon at 7 animo acid behind Asp(D10 Afs*7), which would serious truncate RPGR protein. The novel frame-shift mutation was found to segregate with retinitis pigmentosa(RP) phenotype in this family. Bilateral myopia was present on the male patients, but carrier female showed unilateral myopia without RP.CONCLUSION: Our study identifies a novel frame-shift mutation of RPGR in a Chinese family, which would expand the spectrum of RPGR mutations. The geno-phenotypic analysis reveals a correlation between RP and myopia. Although exact mechanism of RP related myopia is still unknown, but the novel frame-shift mutation will give our hit on studying the molecular pathogenesis of RP and myopia.