AIM:To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosisptosis-epicanthus inversus syndrome(BPES).METHODS:Thirteen patients with BPES and eight healthy fam...AIM:To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosisptosis-epicanthus inversus syndrome(BPES).METHODS:Thirteen patients with BPES and eight healthy family members were included in this study.All participants received routine ophthalmic examinations.The target next-generation sequencing(NGS)was performed to determine the causative mutation for this family.The silico analysis was also applied to predict the pathogenesis of identified mutations.RESULTS:All patients had severe ptosis,normal intelligence,female patients have normal fertility.Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene,c.672_701 ins GCGGCTGCCGC CGCAGCTGCTG CAGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA),carried by 13 patient but absent in all unaffected members.In silico analysis supported the pathogenic nature of this highly conserved variant.This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain,which increased the number of original polyalanine chains from 14 to 24,resulting in an extended protein.CONCLUSION:A novel FOXL2 mutation c.672_701 ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA)was identified in a large Chinese family with BPES.This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotypecorrelations,which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.展开更多
AIM:To describe the prevalence and demographic characteristics of corneal blindness in an urban and rural region of Ningxia,located in the northwest part of China.METHODS:A stratified,randomized sampling procedure was...AIM:To describe the prevalence and demographic characteristics of corneal blindness in an urban and rural region of Ningxia,located in the northwest part of China.METHODS:A stratified,randomized sampling procedure was employed in the study,including urban and rural area of all age group.Visual acuity,anterior segment and ocular fundus were checked.Related factor of corneal disease,including age,gender,education status,ethnic group,location and occupation,were identified according to uniform customized protocol.An eye was defined to be corneal blindness if the visual acuity was【20/400 due to a corneal disease.RESULTS:Three thousand individuals(1290 from urban area and 1710 from rural area)participated in the investigation,with a response rate of 80.380%.The prevalence of corneal blindness was 0.023%in both eyes and 0.733%in at least one eye.The blindness in at least one eye with varied causes was present in 106participants(3.533%)and in bilateral eyes in 34participants(1.133%).The corneal diseases accounted for 20.754%of blindness in at least one eye and 20.588%of bilateral blindness.The prevalence of corneal disease was higher in older and Han ethnic group,especially those who occupied in agriculture and outdoor work.People with corneal blindness were more likely to be older and lower education.Rural population were more likely to suffer from bilateral corneal blindness than the urban population in≥59-year group(χ2=6.716,P=0.019).Infectious,trauma and immune corneal disease were the three leading causes of corneal disease.Trauma cornealdisease was more likely leading to blindness in one eye.However,infectious and immune corneal diseases make more contribution to the bilateral corneal blindness.CONCLUSION:Corneal blindness is a significant burden of in Ningxia population,encompassing a variety of corneal infections and trauma;the majority of those were avoidable.Health promotion strategies and good hygienic conditions have to be developed.展开更多
AIM:To screen mutations in the retinitis pigmentosa 1(RP1) gene and the rhodopsin(RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento(RPSP)and describe the genotype-phenotype relationship of the muta...AIM:To screen mutations in the retinitis pigmentosa 1(RP1) gene and the rhodopsin(RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento(RPSP)and describe the genotype-phenotype relationship of the mutations.·METHODS:Twenty affected,unrelated Chinese individuals with RPSP(4 autosomal dominant RPSP,12autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012.The clinical features were determined by complete ophthalmologic examinations.Polymerase chain reaction(PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1gene and the RHO gene.The cosegregation analysis and population frequency studies were performed for patients with identified mutations.·RESULTS:Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands.Four missense changes(rs444772,rs446227,rs414352,rs441800) and one non-coding variant(rs56340615) were common SNPs and none of them showed a significant relationship with RPSP.A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family,suggestive of pathogenic.In addition,population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls.·CONCLUSION:The identification of p.R1443W mutationcosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation,while RHO gene is not associated with the pathogenesis of RPSP in this study.To our knowledge,this is the fist mutation identified to associate with RPSP.展开更多
文摘AIM:To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosisptosis-epicanthus inversus syndrome(BPES).METHODS:Thirteen patients with BPES and eight healthy family members were included in this study.All participants received routine ophthalmic examinations.The target next-generation sequencing(NGS)was performed to determine the causative mutation for this family.The silico analysis was also applied to predict the pathogenesis of identified mutations.RESULTS:All patients had severe ptosis,normal intelligence,female patients have normal fertility.Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene,c.672_701 ins GCGGCTGCCGC CGCAGCTGCTG CAGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA),carried by 13 patient but absent in all unaffected members.In silico analysis supported the pathogenic nature of this highly conserved variant.This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain,which increased the number of original polyalanine chains from 14 to 24,resulting in an extended protein.CONCLUSION:A novel FOXL2 mutation c.672_701 ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA)was identified in a large Chinese family with BPES.This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotypecorrelations,which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.
基金Supported by Consultation Program of Chinese Academy of Engineering(No.2009-77)Research Program of Ningxia Science and Technology Department(No.NKJ2010-168)
文摘AIM:To describe the prevalence and demographic characteristics of corneal blindness in an urban and rural region of Ningxia,located in the northwest part of China.METHODS:A stratified,randomized sampling procedure was employed in the study,including urban and rural area of all age group.Visual acuity,anterior segment and ocular fundus were checked.Related factor of corneal disease,including age,gender,education status,ethnic group,location and occupation,were identified according to uniform customized protocol.An eye was defined to be corneal blindness if the visual acuity was【20/400 due to a corneal disease.RESULTS:Three thousand individuals(1290 from urban area and 1710 from rural area)participated in the investigation,with a response rate of 80.380%.The prevalence of corneal blindness was 0.023%in both eyes and 0.733%in at least one eye.The blindness in at least one eye with varied causes was present in 106participants(3.533%)and in bilateral eyes in 34participants(1.133%).The corneal diseases accounted for 20.754%of blindness in at least one eye and 20.588%of bilateral blindness.The prevalence of corneal disease was higher in older and Han ethnic group,especially those who occupied in agriculture and outdoor work.People with corneal blindness were more likely to be older and lower education.Rural population were more likely to suffer from bilateral corneal blindness than the urban population in≥59-year group(χ2=6.716,P=0.019).Infectious,trauma and immune corneal disease were the three leading causes of corneal disease.Trauma cornealdisease was more likely leading to blindness in one eye.However,infectious and immune corneal diseases make more contribution to the bilateral corneal blindness.CONCLUSION:Corneal blindness is a significant burden of in Ningxia population,encompassing a variety of corneal infections and trauma;the majority of those were avoidable.Health promotion strategies and good hygienic conditions have to be developed.
基金Ningxia Scientific and Technological Projects from Department of Science and Technology in Ningxia Hui Autonomous Region (No.2011ZYS175)
文摘AIM:To screen mutations in the retinitis pigmentosa 1(RP1) gene and the rhodopsin(RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento(RPSP)and describe the genotype-phenotype relationship of the mutations.·METHODS:Twenty affected,unrelated Chinese individuals with RPSP(4 autosomal dominant RPSP,12autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012.The clinical features were determined by complete ophthalmologic examinations.Polymerase chain reaction(PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1gene and the RHO gene.The cosegregation analysis and population frequency studies were performed for patients with identified mutations.·RESULTS:Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands.Four missense changes(rs444772,rs446227,rs414352,rs441800) and one non-coding variant(rs56340615) were common SNPs and none of them showed a significant relationship with RPSP.A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family,suggestive of pathogenic.In addition,population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls.·CONCLUSION:The identification of p.R1443W mutationcosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation,while RHO gene is not associated with the pathogenesis of RPSP in this study.To our knowledge,this is the fist mutation identified to associate with RPSP.