ZCCHC3 modulates TLR3-mediated signaling by promoting recruitment of TRIF to TLR3

Toll-like receptor 3(TLR3)-mediated signaling is important for host defense against RNA virus.Upon viral RNA stimulation,toll and interleukin-1 receptor domain-containing adaptor inducing IFN-p(TRIF)is recruited to TLR3 and then undergoes oligomerization,which is required for the recruitment of downstream molecules to transmit signals.Here,we identified zinc finger CCHC-type containing 3(ZCCHC3)as a positive regulator of TLR3-mediated signaling.Overexpression of ZCCHC3 promoted transcription of downstream antiviral genes stimulated by the synthetic TLR3 ligand poly(I:C).ZCCHC3-deficiency markedly inhibited TLR3-but not TLR4-mediated induction of type I interferons(IFNs)and proinflammatory cytokines.Zcc/7c3-/-mice were more resistant to poly(l:C)-but not lipopolysaccharide-induced inflammatory death.Mechanistically,ZCCHC3 promoted recruitment of TRIF to TLR3 after poly(l:C)stimulation.Our findings reveal that ZCCHC3 plays an important role in TLR3-mediated innate immune response by promoting the recruitment of TRIF to TLR3 after ligand stimulation.

The zinc-finger protein ZFYVE1 modulates TLR3-mediated signaling by facilitating TLR3 ligand binding

Recognition of viral dsRNA by Toll-like receptor 3(TLR3)leads to the induction of downstream antiviral effectors and the innate antiviral immune response.Here,we identified the zinc-finger FYVE domain-containing protein ZFYVE1,a guanylate-binding protein(GBP),as a positive regulator of TLR3-mediated signaling.Overexpression of ZFYVE1 promoted the transcription of downstream antiviral genes upon stimulation with the synthetic TLR3 ligand poly(I:C).Conversely,ZFYVE1 deficiency had the opposite effect.Zfyve1^(−/−) mice were less susceptible than wild-type mice to inflammatory death induced by poly(I:C)but not LPS.ZFYVE1 was associated with TLR3,and the FYVE domain of ZFYVE1 and the ectodomain of TLR3 were shown to be responsible for their interaction.ZFYVE1 was bound to poly(I:C)and increased the binding affinity of TLR3 to poly(I:C).These findings suggest that ZFYVE1 plays an important role in the TLR3-mediated innate immune and inflammatory responses by promoting the ligand binding of TLR3.

Anti-viral memory T cell responses in the absence of IgG production in a COVID-19 convalescent individual

Cellular and humoral immunity are both important in host defense against severe acute respiratory syndrome coronavirus 2(SARS-CoV-2).Although defects in SARS-CoV-2-specific T cell immunity have been found in patients with severe lung pathology,it is still largely unclear whether virus-specific T cells are sufficient for host protection.Here,we found that in a previously characterized cohort of convalescent subjects,one individual,though lacking detectable anti-viral neutralizing IgG antibodies,showed virus-specific T cell responses,both in CD4^(+)and CD8^(+)T cells.SARS-CoV-2-specific T cells in this and other individuals are maintained for up to 10 months.This study thus further supports a critical role of T cells in host defense against SARS-CoV-2,offering new insights into the design and evaluation of COVID-19 vaccines.

A facile phototheranostic nanoplatform integrating NIR-Ⅱ fluorescence/PA bimodal imaging and image-guided surgery/PTT combinational therapy for improved antitumor efcacy

Phototheranostic with highly integrated functions is an attractive platform for cancer management. It remains challenging to develop a facile phototheranostic platform with complementary bimodal imaging and combinational therapy capacity. Herein, the small-molecule cyanine IR780 loaded liposomes have been harnessed as a nanoplatform to simultaneously realize photoacoustic(PA)/the second near-infrared window(NIR-Ⅱ) fluorescence imaging and image-guided surgery/adjuvant photothermal therapy(PTT).This nanoplatform exhibits attractive properties like uniform controllable size, stable dispersibility, NIR-Ⅱ fluorescence emission, photothermal conversion, and biocompatibility. Benefiting from the complementary PA/NIR-Ⅱ fluorescence bimodal imaging, this nanoplatform was successfully applied in precise vasculature delineation and tumor diagnosis. Interestingly, the tumor was clearly detected by NIR-Ⅱ fluorescence imaging with the highest tumor-to-normal-tissue ratio up to 12.69, while signal interference from the liver was significantly reduced, due to the difference in the elimination rate of the nanoplatform in the liver and tumor. Under the precise guidance of the image, the tumor was accurately resected, and the simulated residual lesion after surgery was completely ablated by adjuvant PTT. This combined therapy showed improved antitumor efcacy over the individual surgery or PTT. This work develops a facile phototheranostic nanoplatform with great significance in accurately diagnosing and effectively treating tumors using simple NIR light irradiation.

Correction to: SNX8 modulates the innate immune response to RNA viruses by regulating the aggregation of VISA

In the version of this article initially published,three unintended errors were made during manuscript preparation.(1)The caption of Fig 4a was incorrect,and the correct statement is‘Effects of SNX8-deficiency on virus-induced death of mice.Mice were infected intraperitoneally(i.p.)with VSV at 5×107 pfu per mouse(n=10 for each genotype)or EMCV at 5×106 pfu per mouse(n=10 for Snx8+/+,n=11 for Snx8−/−).Mouse survival was observed and recorded for 12 days.’(2)Fig 2a and Fig 2e were represented erroneously.The correct Fig 2 is shown below.(3)Typos were found in the description of the qPCR primers for GAPDH and IFNB1 in the Material and Method section,the correct primers are'GAPDH GAGTCAACGGATTTGGTCGT(forward)and GACAAGCTTCCCGTTCTCAG(reverse);IFNB1 TTGTTGAGAACCTC CTGGCT(forward)and TGACTATGGTCCAGGCACAG(reverse)'.The results and conclusions are not affected.