In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondri...In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.展开更多
Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA...Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.展开更多
Plant RNA N-glycosidase specifically hydrolyzes the N-C glycosidic bond of a conserved adenosine in the sarcin/ricin domain of the largest RNA in ribosome, releasing an adenine base and thus inhibiting protein synthes...Plant RNA N-glycosidase specifically hydrolyzes the N-C glycosidic bond of a conserved adenosine in the sarcin/ricin domain of the largest RNA in ribosome, releasing an adenine base and thus inhibiting protein synthesis. This substrate specificity was challenged later by discovery that various RNA derivatives and DNAs, especially the double-stranded supercoiled DNA could be used as substrate by RNA N-glycosidase. Thus, it was argued whether the DNA-cleaving activity was an intrinsic feature of RNA N-glycosidase or it was contaminated by DNase. In this article, several lines of evidence are presented to show that RNA N-glycosidase can really release the adenine base from the double-stranded supercoi/ed DNA. It was proposed that the cleavage mechanism of supercoiled DNA was the phosphodiester bonds in enzymatically deadenylated regions of the supercoiled DNA would become fragile and liable to produce nicked or linear form owing to the existence of tension in the supercoiled DNA molecule, not direct result of enzymatic action on the phosphodiester bond.展开更多
Acute ischemic stroke is a clinical emergency and a condition with high morbidity,mortality,and disability.Accurate predictive,diagnostic,and prognostic biomarkers and effective therapeutic targets for acute ischemic ...Acute ischemic stroke is a clinical emergency and a condition with high morbidity,mortality,and disability.Accurate predictive,diagnostic,and prognostic biomarkers and effective therapeutic targets for acute ischemic stroke remain undetermined.With innovations in high-throughput gene sequencing analysis,many aberrantly expressed non-coding RNAs(ncRNAs)in the brain and peripheral blood after acute ischemic stroke have been found in clinical samples and experimental models.Differentially expressed ncRNAs in the post-stroke brain were demonstrated to play vital roles in pathological processes,leading to neuroprotection or deterioration,thus ncRNAs can serve as therapeutic targets in acute ischemic stroke.Moreover,distinctly expressed ncRNAs in the peripheral blood can be used as biomarkers for acute ischemic stroke prediction,diagnosis,and prognosis.In particular,ncRNAs in peripheral immune cells were recently shown to be involved in the peripheral and brain immune response after acute ischemic stroke.In this review,we consolidate the latest progress of research into the roles of ncRNAs(microRNAs,long ncRNAs,and circular RNAs)in the pathological processes of acute ischemic stroke–induced brain damage,as well as the potential of these ncRNAs to act as biomarkers for acute ischemic stroke prediction,diagnosis,and prognosis.Findings from this review will provide novel ideas for the clinical application of ncRNAs in acute ischemic stroke.展开更多
The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the prese...The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.展开更多
BACKGROUND:Adeno-associated virus(AAV)gene therapy has been proven to be reliable and safe for the treatment of osteoarthritis in recent years.However,given the complexity of osteoarthritis pathogenesis,single gene ma...BACKGROUND:Adeno-associated virus(AAV)gene therapy has been proven to be reliable and safe for the treatment of osteoarthritis in recent years.However,given the complexity of osteoarthritis pathogenesis,single gene manipulation for the treatment of osteoarthritis may not produce satisfactory results.Previous studies have shown that nuclear factorκB could promote the inflammatory pathway in osteoarthritic chondrocytes,and bone morphogenetic protein 4(BMP4)could promote cartilage regeneration.OBJECTIVE:To test whether combined application of AAV-p65shRNA and AAV-BMP4 will yield the synergistic effect on chondrocytes regeneration and osteoarthritis treatment.METHODS:Viral particles containing AAV-p65-shRNA and AAV-BMP4 were prepared.Their efficacy in inhibiting inflammation in chondrocytes and promoting chondrogenesis was assessed in vitro and in vivo by transfecting AAV-p65-shRNA or AAV-BMP4 into cells.The experiments were divided into five groups:PBS group;osteoarthritis group;AAV-BMP4 group;AAV-p65shRNA group;and BMP4-p65shRNA 1:1 group.Samples were collected at 4,12,and 24 weeks postoperatively.Tissue staining,including safranin O and Alcian blue,was applied after collecting articular tissue.Then,the optimal ratio between the two types of transfected viral particles was further investigated to improve the chondrogenic potential of mixed cells in vivo.RESULTS AND CONCLUSION:The combined application of AAV-p65shRNA and AAV-BMP4 together showed a synergistic effect on cartilage regeneration and osteoarthritis treatment.Mixed cells transfected with AAV-p65shRNA and AAV-BMP4 at a 1:1 ratio produced the most extracellular matrix synthesis(P<0.05).In vivo results also revealed that the combination of the two viruses had the highest regenerative potential for osteoarthritic cartilage(P<0.05).In the present study,we also discovered that the combined therapy had the maximum effect when the two viruses were administered in equal proportions.Decreasing either p65shRNA or BMP4 transfected cells resulted in less collagen II synthesis.This implies that inhibiting inflammation by p65shRNA and promoting regeneration by BMP4 are equally important for osteoarthritis treatment.These findings provide a new strategy for the treatment of early osteoarthritis by simultaneously inhibiting cartilage inflammation and promoting cartilage repair.展开更多
文摘In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.
文摘Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.
文摘Plant RNA N-glycosidase specifically hydrolyzes the N-C glycosidic bond of a conserved adenosine in the sarcin/ricin domain of the largest RNA in ribosome, releasing an adenine base and thus inhibiting protein synthesis. This substrate specificity was challenged later by discovery that various RNA derivatives and DNAs, especially the double-stranded supercoiled DNA could be used as substrate by RNA N-glycosidase. Thus, it was argued whether the DNA-cleaving activity was an intrinsic feature of RNA N-glycosidase or it was contaminated by DNase. In this article, several lines of evidence are presented to show that RNA N-glycosidase can really release the adenine base from the double-stranded supercoi/ed DNA. It was proposed that the cleavage mechanism of supercoiled DNA was the phosphodiester bonds in enzymatically deadenylated regions of the supercoiled DNA would become fragile and liable to produce nicked or linear form owing to the existence of tension in the supercoiled DNA molecule, not direct result of enzymatic action on the phosphodiester bond.
基金supported by the National Natural Science Foundation of China,Nos.82301486(to SL)and 82071325(to FY)Medjaden Academy&Research Foundation for Young Scientists,No.MJR202310040(to SL)+2 种基金Nanjing Medical University Science and Technique Development,No.NMUB20220060(to SL)Medical Scientific Research Project of Jiangsu Commission of Health,No.ZDA2020019(to JZ)Health China Buchang Zhiyuan Public Welfare Project for Heart and Brain Health,No.HIGHER202102(to QD).
文摘Acute ischemic stroke is a clinical emergency and a condition with high morbidity,mortality,and disability.Accurate predictive,diagnostic,and prognostic biomarkers and effective therapeutic targets for acute ischemic stroke remain undetermined.With innovations in high-throughput gene sequencing analysis,many aberrantly expressed non-coding RNAs(ncRNAs)in the brain and peripheral blood after acute ischemic stroke have been found in clinical samples and experimental models.Differentially expressed ncRNAs in the post-stroke brain were demonstrated to play vital roles in pathological processes,leading to neuroprotection or deterioration,thus ncRNAs can serve as therapeutic targets in acute ischemic stroke.Moreover,distinctly expressed ncRNAs in the peripheral blood can be used as biomarkers for acute ischemic stroke prediction,diagnosis,and prognosis.In particular,ncRNAs in peripheral immune cells were recently shown to be involved in the peripheral and brain immune response after acute ischemic stroke.In this review,we consolidate the latest progress of research into the roles of ncRNAs(microRNAs,long ncRNAs,and circular RNAs)in the pathological processes of acute ischemic stroke–induced brain damage,as well as the potential of these ncRNAs to act as biomarkers for acute ischemic stroke prediction,diagnosis,and prognosis.Findings from this review will provide novel ideas for the clinical application of ncRNAs in acute ischemic stroke.
文摘The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.
文摘BACKGROUND:Adeno-associated virus(AAV)gene therapy has been proven to be reliable and safe for the treatment of osteoarthritis in recent years.However,given the complexity of osteoarthritis pathogenesis,single gene manipulation for the treatment of osteoarthritis may not produce satisfactory results.Previous studies have shown that nuclear factorκB could promote the inflammatory pathway in osteoarthritic chondrocytes,and bone morphogenetic protein 4(BMP4)could promote cartilage regeneration.OBJECTIVE:To test whether combined application of AAV-p65shRNA and AAV-BMP4 will yield the synergistic effect on chondrocytes regeneration and osteoarthritis treatment.METHODS:Viral particles containing AAV-p65-shRNA and AAV-BMP4 were prepared.Their efficacy in inhibiting inflammation in chondrocytes and promoting chondrogenesis was assessed in vitro and in vivo by transfecting AAV-p65-shRNA or AAV-BMP4 into cells.The experiments were divided into five groups:PBS group;osteoarthritis group;AAV-BMP4 group;AAV-p65shRNA group;and BMP4-p65shRNA 1:1 group.Samples were collected at 4,12,and 24 weeks postoperatively.Tissue staining,including safranin O and Alcian blue,was applied after collecting articular tissue.Then,the optimal ratio between the two types of transfected viral particles was further investigated to improve the chondrogenic potential of mixed cells in vivo.RESULTS AND CONCLUSION:The combined application of AAV-p65shRNA and AAV-BMP4 together showed a synergistic effect on cartilage regeneration and osteoarthritis treatment.Mixed cells transfected with AAV-p65shRNA and AAV-BMP4 at a 1:1 ratio produced the most extracellular matrix synthesis(P<0.05).In vivo results also revealed that the combination of the two viruses had the highest regenerative potential for osteoarthritic cartilage(P<0.05).In the present study,we also discovered that the combined therapy had the maximum effect when the two viruses were administered in equal proportions.Decreasing either p65shRNA or BMP4 transfected cells resulted in less collagen II synthesis.This implies that inhibiting inflammation by p65shRNA and promoting regeneration by BMP4 are equally important for osteoarthritis treatment.These findings provide a new strategy for the treatment of early osteoarthritis by simultaneously inhibiting cartilage inflammation and promoting cartilage repair.
