BACKGROUND The possible existence of an acini–islet–acinar(AIA)reflex,involving mutual amylase and insulin interactions,was investigated in the current acute experiment on pigs.AIM To confirm the existence of an AIA...BACKGROUND The possible existence of an acini–islet–acinar(AIA)reflex,involving mutual amylase and insulin interactions,was investigated in the current acute experiment on pigs.AIM To confirm the existence of an AIA reflex and justify the placement of the exocrine and endocrine pancreatic components within the same organ.METHODS The study was performed on six pigs under general anesthesia.An intravenous glucose tolerance test was performed,with a bolus infusion of 50%glucose to the jugular vein,while amylase(5000 U/kg)or vehicle intrapancreatic infusions were administered via the pancreaticoduodenalis cranialis artery during 30 min with a 1 mL/min flow rate.RESULTS The amylase infusion to pancreatic arterial circulation inhibited and delayed the insulin release peak which is usually associated with the highest value of blood glucose and is typically observed at 15 min after glucose infusion,for>1 h.The intrapancreatic infusion of the vehicle(saline)did not have any effect on the time frame of insulin release.Infusion of 1%bovine serum albumin changed the insulin release curve dramatically and prolonged the high range of insulin secretion,far beyond the glucose peak.CONCLUSION Intrapancreatic arterial infusion of amylase interrupted the integrated glucose–insulin interactions.This confirms an AIA reflex and justifies placement of the exocrine and endocrine pancreatic components within the same organ.展开更多
This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
An α-amylase encoding gene was amplified by polymerase chain reaction from Saccharomycopsis fibuligeru and inserted into a shuttle vector YEp352,together with the yeast phosphoglycerate kinase 1 prumoter and a-factor...An α-amylase encoding gene was amplified by polymerase chain reaction from Saccharomycopsis fibuligeru and inserted into a shuttle vector YEp352,together with the yeast phosphoglycerate kinase 1 prumoter and a-factor signal gene. The recombinant expression plasmid pLA8α was transformed into an industrial strain of Saccharomycopsis cerevisiae Sc-11. The activity of the α-amylase produced by the transformant Sc-11-pLA8α was 6.3 U/mL and the starch utilization rate in YPS medium was 42%. The purified amylase was analyzed by SDS-PAGE,showing a molecular weight of 55×10^3 protein band. Furthermore, the residual sugar, ethanol and some volatile compounds in the fermented worts under simulating brewing conditions were determined by chromatographic analyses. The fermentation characteristics of Sc-ll-pLA8α were similar to that of Sc-ll and only minor changes in the concentration of flavor compounds could be observed.展开更多
BACKGROUND Validation of the reference gene(RG)stability during experimental analyses is essential for correct quantitative real-time polymerase chain reaction(RT-qPCR)data normalisation.Commonly,in an unreliable way,...BACKGROUND Validation of the reference gene(RG)stability during experimental analyses is essential for correct quantitative real-time polymerase chain reaction(RT-qPCR)data normalisation.Commonly,in an unreliable way,several studies use genes involved in essential cellular functions[glyceraldehyde-3-phosphate dehydro-genase(GAPDH),18S rRNA,andβ-actin]without paying attention to whether they are suitable for such experimental conditions or the reason for choosing such genes.Furthermore,such studies use only one gene when Minimum Information for Publication of Quantitative Real-Time PCR Experiments guidelines recom-mend two or more genes.It impacts the credibility of these studies and causes dis-tortions in the gene expression findings.For tissue engineering,the accuracy of gene expression drives the best experimental or therapeutical approaches.We cultivated DPSCs under two conditions:Undifferentiated and osteogenic dif-ferentiation,both for 35 d.We evaluated the gene expression of 10 candidates for RGs[ribosomal protein,large,P0(RPLP0),TATA-binding protein(TBP),GAPDH,actin beta(ACTB),tubulin(TUB),aminolevulinic acid synthase 1(ALAS1),tyro-sine 3-monooxygenase/tryptophan 5-monooxygenase activation protein,zeta(YWHAZ),eukaryotic translational elongation factor 1 alpha(EF1a),succinate dehydrogenase complex,subunit A,flavoprotein(SDHA),and beta-2-micro-globulin(B2M)]every 7 d(1,7,14,21,28,and 35 d)by RT-qPCR.The data were analysed by the four main algorithms,ΔCt method,geNorm,NormFinder,and BestKeeper and ranked by the RefFinder method.We subdivided the samples into eight subgroups.RESULTS All of the data sets from clonogenic and osteogenic samples were analysed using the RefFinder algorithm.The final ranking showed RPLP0/TBP as the two most stable RGs and TUB/B2M as the two least stable RGs.Either theΔCt method or NormFinder analysis showed TBP/RPLP0 as the two most stable genes.However,geNorm analysis showed RPLP0/EF1αin the first place.These algorithms’two least stable RGs were B2M/GAPDH.For BestKeeper,ALAS1 was ranked as the most stable RG,and SDHA as the least stable RG.The pair RPLP0/TBP was detected in most subgroups as the most stable RGs,following the RefFinfer ranking.CONCLUSION For the first time,we show that RPLP0/TBP are the most stable RGs,whereas TUB/B2M are unstable RGs for long-term osteogenic differentiation of human DPSCs in traditional monolayers.展开更多
Grain weight is one of the key components of wheat(Triticum aestivum L.)yield.Genetic manipulation of grain weight is an efficient approach for improving yield potential in breeding programs.A recombinant inbred line(...Grain weight is one of the key components of wheat(Triticum aestivum L.)yield.Genetic manipulation of grain weight is an efficient approach for improving yield potential in breeding programs.A recombinant inbred line(RIL)population derived from a cross between W7268 and Chuanyu 12(CY12)was employed to detect quantitative trait loci(QTLs)for thousand-grain weight(TGW),grain length(GL),grain width(GW),and the ratio of grain length to width(GLW)in six environments.Seven major QTLs,QGl.cib-2D,QGw.cib-2D,QGw.cib-3B,QGw.cib-4B.1,QGlw.cib-2D.1,QTgw.cib-2D.1 and QTgw.cib-3B.1,were consistently identified in at least four environments and the best linear unbiased estimation(BLUE)datasets,and they explained 2.61 to 34.85%of the phenotypic variance.Significant interactions were detected between the two major TGW QTLs and three major GW loci.In addition,QTgw.cib-3B.1 and QGw.cib-3B were co-located,and the improved TGW at this locus was contributed by GW.Unlike other loci,QTgw.cib-3B.1/QGw.cib-3B had no effect on grain number per spike(GNS).They were further validated in advanced lines using Kompetitive Allele Specific PCR(KASP)markers,and a comparison analysis indicated that QTgw.cib-3B.1/QGw.cib-3B is likely a novel locus.Six haplotypes were identified in the region of this QTL and their distribution frequencies varied between the landraces and cultivars.According to gene annotation,spatial expression patterns,ortholog analysis and sequence variation,the candidate gene of QTgw.cib-3B.1/QGw.cib-3B was predicted.Collectively,the major QTLs and KASP markers reported here provide valuable information for elucidating the genetic architecture of grain weight and for molecular marker-assisted breeding in grain yield improvement.展开更多
Alzheimer’s disease is a progressive neurodegenerative disorder and the most common cause of dementia that principally affects older adults.Pathogenic factors,such as oxidative stress,an increase in acetylcholinester...Alzheimer’s disease is a progressive neurodegenerative disorder and the most common cause of dementia that principally affects older adults.Pathogenic factors,such as oxidative stress,an increase in acetylcholinesterase activity,mitochondrial dysfunction,genotoxicity,and neuroinflammation are present in this syndrome,which leads to neurodegeneration.Neurodegenerative pathologies such as Alzheimer’s disease are considered late-onset diseases caused by the complex combination of genetic,epigenetic,and environmental factors.There are two main types of Alzheimer’s disease,known as familial Alzheimer’s disease(onset<65 years)and late-onset or sporadic Alzheimer’s disease(onset≥65 years).Patients with familial Alzheimer’s disease inherit the disease due to rare mutations on the amyloid precursor protein(APP),presenilin 1 and 2(PSEN1 and PSEN2)genes in an autosomaldominantly fashion with closely 100%penetrance.In contrast,a different picture seems to emerge for sporadic Alzheimer’s disease,which exhibits numerous non-Mendelian anomalies suggesting an epigenetic component in its etiology.Importantly,the fundamental pathophysiological mechanisms driving Alzheimer’s disease are interfaced with epigenetic dysregulation.However,the dynamic nature of epigenetics seems to open up new avenues and hope in regenerative neurogenesis to improve brain repair in Alzheimer’s disease or following injury or stroke in humans.In recent years,there has been an increase in interest in using natural products for the treatment of neurodegenerative illnesses such as Alzheimer’s disease.Through epigenetic mechanisms,such as DNA methylation,non-coding RNAs,histone modification,and chromatin conformation regulation,natural compounds appear to exert neuroprotective effects.While we do not purport to cover every in this work,we do attempt to illustrate how various phytochemical compounds regulate the epigenetic effects of a few Alzheimer’s disease-related genes.展开更多
Noncoding RNAs instruct the Cas9 nuclease to site speifillyl cleave DNA in the CRISPR/Cas9 system.Despite the high incidence of hepatocellular carcinoma(HCC),the patient's outcome is poor.As a result of the emerge...Noncoding RNAs instruct the Cas9 nuclease to site speifillyl cleave DNA in the CRISPR/Cas9 system.Despite the high incidence of hepatocellular carcinoma(HCC),the patient's outcome is poor.As a result of the emergence of therapeutic resistance in HCC patients,dlinicians have faced difficulties in treating such tumor.In addition,CRISPR/Cas9 screens were used to identify genes that improve the dlinical response of HCC patients.It is the objective of this article to summarize the current understanding of the use of the CRISPR/Cas9 system for the treatment of cancer,with a particular emphasis on HCC as part of the current state of knowledge.Thus,in order to locate recent developments in oncology research,we examined both the Scopus database and the PubMed database.The ability to selectively interfere with gene expression in combinatorial CRISPR/Cas9 screening can lead to the discovery of new effective HCC treatment regimens by combining clinically approved drugs.Drug resistance can be overcome with the help of the CRISPR/Cas9 system.HCC signature genes and resistance to treatment have been uncovered by genome-scale CRISPR activation screening although this method is not without limitations.It has been extensively examined whether CRISPR can be used as a tool for disease research and gene therapy.CRISPR and its applications to tumor research,particularly in HCC,are examined in this study through a review of the literature.展开更多
Neurodegenerative diseases(NDs)are a group of debilitating neurological disorders that primarily affect elderly populations and include Alzheimer's disease(AD),Parkinson's disease(PD),Huntington's disease(...Neurodegenerative diseases(NDs)are a group of debilitating neurological disorders that primarily affect elderly populations and include Alzheimer's disease(AD),Parkinson's disease(PD),Huntington's disease(HD),and amyotrophic lateral sclerosis(ALS).Currently,there are no therapies available that can delay,stop,or reverse the pathological progression of NDs in clinical settings.As the population ages,NDs are imposing a huge burden on public health systems and affected families.Animal models are important tools for preclinical investigations to understand disease pathogenesis and test potential treatments.While numerous rodent models of NDs have been developed to enhance our understanding of disease mechanisms,the limited success of translating findings from animal models to clinical practice suggests that there is still a need to bridge this translation gap.Old World nonhuman primates(NHPs),such as rhesus,cynomolgus,and vervet monkeys,are phylogenetically,physiologically,biochemically,and behaviorally most relevant to humans.This is particularly evident in the similarity of the structure and function of their central nervous systems,rendering such species uniquely valuable for neuroscience research.Recently,the development of several genetically modified NHP models of NDs has successfully recapitulated key pathologies and revealed novel mechanisms.This review focuses on the efficacy of NHPs in modeling NDs and the novel pathological insights gained,as well as the challenges associated with the generation of such models and the complexities involved in their subsequent analysis.展开更多
Background The genetic diversity of yak,a key domestic animal on the Qinghai-Tibetan Plateau(QTP),is a vital resource for domestication and breeding efforts.This study presents the first yak pangenome obtained through...Background The genetic diversity of yak,a key domestic animal on the Qinghai-Tibetan Plateau(QTP),is a vital resource for domestication and breeding efforts.This study presents the first yak pangenome obtained through the de novo assembly of 16 yak genomes.Results We discovered 290 Mb of nonreference sequences and 504 new genes.Our pangenome-wide presence and absence variation(PAV)analysis revealed 5,120 PAV-related genes,highlighting a wide range of variety-specific genes and genes with varying frequencies across yak populations.Principal component analysis(PCA)based on binary gene PAV data classified yaks into three new groups:wild,domestic,and Jinchuan.Moreover,we pro-posed a‘two-haplotype genomic hybridization model'for understanding the hybridization patterns among breeds by integrating gene frequency,heterozygosity,and gene PAV data.A gene PAV-GWAS identified a novel gene(Bos-Gru3G009179)that may be associated with the multirib trait in Jinchuan yaks.Furthermore,an integrated transcrip-tome and pangenome analysis highlighted the significant differences in the expression of core genes and the muta-tional burden of differentially expressed genes between yaks from high and low altitudes.Transcriptome analysis across multiple species revealed that yaks have the most unique differentially expressed m RNAs and lnc RNAs(between high-and low-altitude regions),especially in the heart and lungs,when comparing high-and low-altitude adaptations.Conclusions The yak pangenome offers a comprehensive resource and new insights for functional genomic studies,supporting future biological research and breeding strategies.展开更多
BACKGROUND Helicobacter pylori(H.pylori)infection is related to various extragastric diseases including type 2 diabetes mellitus(T2DM).However,the possible mechanisms connecting H.pylori infection and T2DM remain unkn...BACKGROUND Helicobacter pylori(H.pylori)infection is related to various extragastric diseases including type 2 diabetes mellitus(T2DM).However,the possible mechanisms connecting H.pylori infection and T2DM remain unknown.AIM To explore potential molecular connections between H.pylori infection and T2DM.METHODS We extracted gene expression arrays from three online datasets(GSE60427,GSE27411 and GSE115601).Differentially expressed genes(DEGs)commonly present in patients with H.pylori infection and T2DM were identified.Hub genes were validated using human gastric biopsy samples.Correlations between hub genes and immune cell infiltration,miRNAs,and transcription factors(TFs)were further analyzed.RESULTS A total of 67 DEGs were commonly presented in patients with H.pylori infection and T2DM.Five significantly upregulated hub genes,including TLR4,ITGAM,C5AR1,FCER1G,and FCGR2A,were finally identified,all of which are closely related to immune cell infiltration.The gene-miRNA analysis detected 13 miRNAs with at least two gene cross-links.TF-gene interaction networks showed that TLR4 was coregulated by 26 TFs,the largest number of TFs among the 5 hub genes.CONCLUSION We identified five hub genes that may have molecular connections between H.pylori infection and T2DM.This study provides new insights into the pathogenesis of H.pylori-induced onset of T2DM.展开更多
Exosomes exhibit complex biological functions and mediate a variety of biological processes,such as promoting axonal regeneration and functional recove ry after injury.Long non-coding RNAs(IncRNAs)have been reported t...Exosomes exhibit complex biological functions and mediate a variety of biological processes,such as promoting axonal regeneration and functional recove ry after injury.Long non-coding RNAs(IncRNAs)have been reported to play a crucial role in axonal regeneration.Howeve r,the role of the IncRNA-microRNAmessenger RNA(mRNA)-competitive endogenous RNA(ceRNA)network in exosome-mediated axonal regeneration remains unclear.In this study,we performed RNA transcriptome sequencing analysis to assess mRNA expression patterns in exosomes produced by cultured fibroblasts(FC-EXOs)and Schwann cells(SCEXOs).Diffe rential gene expression analysis,Gene Ontology analysis,Kyoto Encyclopedia of Genes and Genomes analysis,and protein-protein intera ction network analysis were used to explo re the functions and related pathways of RNAs isolated from FC-EXOs and SC-EXOs.We found that the ribosome-related central gene Rps5 was enriched in FC-EXOs and SC-EXOs,which suggests that it may promote axonal regeneration.In addition,using the miRWalk and Starbase prediction databases,we constructed a regulatory network of ceRNAs targeting Rps5,including 27 microRNAs and five IncRNAs.The ceRNA regulatory network,which included Ftx and Miat,revealed that exsosome-derived Rps5 inhibits scar formation and promotes axonal regeneration and functional recovery after nerve injury.Our findings suggest that exosomes derived from fibro blast and Schwann cells could be used to treat injuries of peripheral nervous system.展开更多
Root system architecture plays an essential role in water and nutrient acquisition in plants,and it is significantly involved in plant adaptations to various environmental stresses.In this study,a panel of 242 cotton ...Root system architecture plays an essential role in water and nutrient acquisition in plants,and it is significantly involved in plant adaptations to various environmental stresses.In this study,a panel of 242 cotton accessions was collected to investigate six root morphological traits at the seedling stage,including main root length(MRL),root fresh weight(RFW),total root length(TRL),root surface area(RSA),root volume(RV),and root average diameter(AvgD).The correlation analysis of the six root morphological traits revealed strong positive correlations of TRL with RSA,as well as RV with RSA and AvgD,whereas a significant negative correlation was found between TRL and AvgD.Subsequently,a genome-wide association study(GWAS)was performed using the root phenotypic and genotypic data reported previously for the 242 accessions using 56,010 single nucleotide polymorphisms(SNPs)from the CottonSNP80K array.A total of 41 quantitative trait loci(QTLs)were identified,including nine for MRL,six for RFW,nine for TRL,12 for RSA,12 for RV and two for AvgD.Among them,eight QTLs were repeatedly detected in two or more traits.Integrating these results with a transcriptome analysis,we identified 17 candidate genes with high transcript values of transcripts per million(TPM)≥30 in the roots.Furthermore,we functionally verified the candidate gene GH_D05G2106,which encodes a WPP domain protein 2in root development.A virus-induced gene silencing(VIGS)assay showed that knocking down GH_D05G2106significantly inhibited root development in cotton,indicating its positive role in root system architecture formation.Collectively,these results provide a theoretical basis and candidate genes for future studies on cotton root developmental biology and root-related cotton breeding.展开更多
Immune changes and inflammatory responses have been identified as central events in the pathological process of spinal co rd injury.They can greatly affect nerve regeneration and functional recovery.However,there is s...Immune changes and inflammatory responses have been identified as central events in the pathological process of spinal co rd injury.They can greatly affect nerve regeneration and functional recovery.However,there is still limited understanding of the peripheral immune inflammato ry response in spinal cord inju ry.In this study.we obtained microRNA expression profiles from the peripheral blood of patients with spinal co rd injury using high-throughput sequencing.We also obtained the mRNA expression profile of spinal cord injury patients from the Gene Expression Omnibus(GEO)database(GSE151371).We identified 54 differentially expressed microRNAs and 1656 diffe rentially expressed genes using bioinformatics approaches.Functional enrichment analysis revealed that various common immune and inflammation-related signaling pathways,such as neutrophil extracellular trap formation pathway,T cell receptor signaling pathway,and nuclear factor-κB signal pathway,we re abnormally activated or inhibited in spinal cord inju ry patient samples.We applied an integrated strategy that combines weighted gene co-expression network analysis,LASSO logistic regression,and SVM-RFE algorithm and identified three biomarke rs associated with spinal cord injury:ANO10,BST1,and ZFP36L2.We verified the expression levels and diagnostic perfo rmance of these three genes in the original training dataset and clinical samples through the receiver operating characteristic curve.Quantitative polymerase chain reaction results showed that ANO20 and BST1 mRNA levels were increased and ZFP36L2 mRNA was decreased in the peripheral blood of spinal cord injury patients.We also constructed a small RNA-mRNA interaction network using Cytoscape.Additionally,we evaluated the proportion of 22 types of immune cells in the peripheral blood of spinal co rd injury patients using the CIBERSORT tool.The proportions of naive B cells,plasma cells,monocytes,and neutrophils were increased while the proportions of memory B cells,CD8^(+)T cells,resting natural killer cells,resting dendritic cells,and eosinophils were markedly decreased in spinal cord injury patients increased compared with healthy subjects,and ANO10,BST1 and ZFP26L2we re closely related to the proportion of certain immune cell types.The findings from this study provide new directions for the development of treatment strategies related to immune inflammation in spinal co rd inju ry and suggest that ANO10,BST2,and ZFP36L2 are potential biomarkers for spinal cord injury.The study was registe red in the Chinese Clinical Trial Registry(registration No.ChiCTR2200066985,December 12,2022).展开更多
●AIM:To investigate the molecular diagnosis of a threegeneration Chinese family affected with aniridia,and further to identify clinically a PAX6 missense mutation in members with atypical aniridia.●METHODS:Eleven fa...●AIM:To investigate the molecular diagnosis of a threegeneration Chinese family affected with aniridia,and further to identify clinically a PAX6 missense mutation in members with atypical aniridia.●METHODS:Eleven family members with and without atypical aniridia were recruited.All family members underwent comprehensive ophthalmic examinations.A combination of whole exome sequencing(WES)and direct Sanger sequencing were performed to uncover the causative mutation.●RESULTS:Among the 11 family members,8 were clinically diagnosed with congenital aniridia(atypical aniridia phenotype).A rare heterozygous mutation c.622C>T(p.Arg208Trp)in exon 8 of PAX6 was identified in all affected family members but not in the unaffected members or in healthy control subjects.●CONCLUSION:A rare missense mutation in the PAX6 gene is found in members of a three-generation Chinese family with congenital atypical aniridia.This result contributes to an increase in the phenotypic spectrum caused by PAX6 missense heterozygous variants and provides useful information for the clinical diagnosis of atypical aniridia,which may also contribute to genetic counselling and family planning.展开更多
Stripe rust,caused by Puccinia striiformis f.sp.tritici(Pst),is a devastating disease in wheat worldwide.Discovering and characterizing new resistance genes/QTL is crucial for wheat breeding programs.In this study,we ...Stripe rust,caused by Puccinia striiformis f.sp.tritici(Pst),is a devastating disease in wheat worldwide.Discovering and characterizing new resistance genes/QTL is crucial for wheat breeding programs.In this study,we fine-mapped and characterized a stripe rust resistance gene,YRAYH,on chromosome arm 5BL in the Chinese wheat landrace Anyuehong(AYH).Evaluations of stripe rust response to prevalent Chinese Pst races in near-isogenic lines derived from a cross of Anyuehong and Taichung 29 showed that YrAYH conferred a high level of resistance at all growth stages.Fine mapping using a large segregating population of 9748 plants,narrowed the YRAYH locus to a 3.7 Mb interval on chromosome arm 5BL that included 61 annotated genes.Transcriptome analysis of two NIL pairs identified 64 upregulated differentially expressed genes(DEGs)in the resistant NILs(NILs-R).Annotations indicated that many of these genes have roles in plant disease resistance pathways.Through a combined approach of fine-mapping and transcriptome sequencing,we identified a serine/threonine-protein kinase SRPK as a candidate gene underlying YrAYH.A unique 25 bp insertion was identified in the NILs-R compared to the NILs-S and previously published wheat genomes.An InDel marker was developed and co-segregated with YrAYH.Agronomic trait evaluation of the NILs suggested that YrAYH not only reduces the impact of stripe rust but was also associated with a gene that increases plant height and spike length.展开更多
Cotton fiber quality is a persistent concern that determines planting benefits and the quality of finished textile products.However,the limitations of measurement instruments have hindered the accurate evaluation of s...Cotton fiber quality is a persistent concern that determines planting benefits and the quality of finished textile products.However,the limitations of measurement instruments have hindered the accurate evaluation of some important fiber characteristics such as fiber maturity,fineness,and neps,which in turn has impeded the genetic improvement and industrial utilization of cotton fiber.Here,12 single fiber quality traits were measured using Advanced Fiber Information System(AFIS)equipment among 383 accessions of upland cotton(Gossypium hirsutum L.).In addition,eight conventional fiber quality traits were assessed by the High Volume Instrument(HVI)System.Genome-wide association study(GWAS),linkage disequilibrium(LD)block genotyping and functional identification were conducted sequentially to uncover the associated elite loci and candidate genes of fiber quality traits.As a result,the previously reported pleiotropic locus FL_D11 regulating fiber length-related traits was identified in this study.More importantly,three novel pleiotropic loci(FM_A03,FF_A05,and FN_A07)regulating fiber maturity,fineness and neps,respectively,were detected based on AFIS traits.Numerous highly promising candidate genes were screened out by integrating RNA-seq and qRT-PCR analyses,including the reported GhKRP6 for fiber length,the newly identified GhMAP8 for maturity and GhDFR for fineness.The origin and evolutionary analysis of pleiotropic loci indicated that the selection pressure on FL_D11,FM_A03 and FF_A05 increased as the breeding period approached the present and the origins of FM_A03 and FF_A05 were traced back to cotton landraces.These findings reveal the genetic basis underlying fiber quality and provide insight into the genetic improvement and textile utilization of fiber in G.hirsutum.展开更多
Verticillium wilt(VW),induced by the soil-borne fungus Verticillium dahliae(Vd),poses a substantial threat to a diverse array of plant species.Employing molecular breeding technology for the development of cotton vari...Verticillium wilt(VW),induced by the soil-borne fungus Verticillium dahliae(Vd),poses a substantial threat to a diverse array of plant species.Employing molecular breeding technology for the development of cotton varieties with heightened resistance to VW stands out as one of the most efficacious protective measures.In this study,we successfully generated two stable transgenic lines of cotton(Gossypium hirsutum L.),VdThitRNAi-1 and VdThit-RNAi-2,using host-induced gene silencing(HIGS)technology to introduce double-stranded RNA(dsRNA)targeting the thiamine transporter protein gene(VdThit).Southern blot analysis confirmed the presence of a single-copy insertion in each line.Microscopic examination showed marked reductions in the colonization and spread of Vd-mCherry in the roots of VdThit-RNAi cotton compared to wild type(WT).The corresponding disease index and fungal biomass of VdThit-RNAi-1/2 also exhibited significant reductions.Real-time quantitative PCR(qRT-PCR)analysis demonstrated a substantial inhibition of VdThit expression following prolonged inoculation of VdThit-RNAi cotton.Small RNA sequencing(sRNA-Seq)analysis revealed the generation of a substantial number of VdThit-specific siRNAs in the VdThit-RNAi transgenic lines.Additionally,the silencing of VdThit by the siVdThit produced by VdThit-RNAi-1/2 resulted in the elevated expression of multiple genes involved in the thiamine biosynthesis pathway in Vd.Under field conditions,VdThit-RNAi transgenic cotton exhibited significantly enhanced disease resistance and yield compared with WT.In summary,our findings underscore the efficacy of HIGS targeting VdThit in restraining the infection and spread of Vd in cotton,thereby potentially enabling the development of cotton breeding as a promising strategy for managing VW.展开更多
Heat shock transcription factors(Hsfs)have important roles during plant growth and development and responses to abiotic stresses.The identification and func-tion of Hsf genes have been thoroughly studied in various he...Heat shock transcription factors(Hsfs)have important roles during plant growth and development and responses to abiotic stresses.The identification and func-tion of Hsf genes have been thoroughly studied in various herbaceous plant species,but not woody species,especially Phoebe bournei,an endangered,unique species in China.In this study,17 members of the Hsf gene family were identi-fied from P.bournei using bioinformatic methods.Phyloge-netic analysis indicated that PbHsf genes were grouped into three subfamilies:A,B,and C.Conserved motifs,three-dimensional structure,and physicochemical properties of the PbHsf proteins were also analyzed.The structure of the PbHsf genes varied in the number of exons and introns.Pre-diction of cis-acting elements in the promoter region indi-cated that PbHsf genes are likely involved in responses to plant hormones and stresses.A collinearity analysis dem-onstrated that expansions of the PbHsf gene family mainly take place via segmental duplication.The expression levels of PbHsf genes varied across different plant tissues.On the basis of the expression profiles of five representative PbHsf genes during heat,cold,salt,and drought stress,PbHsf pro-teins seem to have multiple functions depending on the type of abiotic stress.This systematic,genome-wide investigation of PbHsf genes in P.bournei and their expression patterns provides valuable insights and information for further func-tional dissection of Hsf proteins in this endangered,unique species.展开更多
文摘BACKGROUND The possible existence of an acini–islet–acinar(AIA)reflex,involving mutual amylase and insulin interactions,was investigated in the current acute experiment on pigs.AIM To confirm the existence of an AIA reflex and justify the placement of the exocrine and endocrine pancreatic components within the same organ.METHODS The study was performed on six pigs under general anesthesia.An intravenous glucose tolerance test was performed,with a bolus infusion of 50%glucose to the jugular vein,while amylase(5000 U/kg)or vehicle intrapancreatic infusions were administered via the pancreaticoduodenalis cranialis artery during 30 min with a 1 mL/min flow rate.RESULTS The amylase infusion to pancreatic arterial circulation inhibited and delayed the insulin release peak which is usually associated with the highest value of blood glucose and is typically observed at 15 min after glucose infusion,for>1 h.The intrapancreatic infusion of the vehicle(saline)did not have any effect on the time frame of insulin release.Infusion of 1%bovine serum albumin changed the insulin release curve dramatically and prolonged the high range of insulin secretion,far beyond the glucose peak.CONCLUSION Intrapancreatic arterial infusion of amylase interrupted the integrated glucose–insulin interactions.This confirms an AIA reflex and justifies placement of the exocrine and endocrine pancreatic components within the same organ.
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
基金Supported bythe National Tenth Five-Year Hi-Technique Project(2001BA708B05-04)
文摘An α-amylase encoding gene was amplified by polymerase chain reaction from Saccharomycopsis fibuligeru and inserted into a shuttle vector YEp352,together with the yeast phosphoglycerate kinase 1 prumoter and a-factor signal gene. The recombinant expression plasmid pLA8α was transformed into an industrial strain of Saccharomycopsis cerevisiae Sc-11. The activity of the α-amylase produced by the transformant Sc-11-pLA8α was 6.3 U/mL and the starch utilization rate in YPS medium was 42%. The purified amylase was analyzed by SDS-PAGE,showing a molecular weight of 55×10^3 protein band. Furthermore, the residual sugar, ethanol and some volatile compounds in the fermented worts under simulating brewing conditions were determined by chromatographic analyses. The fermentation characteristics of Sc-ll-pLA8α were similar to that of Sc-ll and only minor changes in the concentration of flavor compounds could be observed.
基金Supported by São Paulo Research Foundation(FAPESP),No.2010/08918-9 and 2020/11564-6the KBSP Young Investigator Fellowship,No.2011/00204-0+2 种基金the DBF Fellowship,No.2019/27492-7the LMG Fellowship,No.2014/01395-1the CFB Fellowship,No.2014/14278-3.
文摘BACKGROUND Validation of the reference gene(RG)stability during experimental analyses is essential for correct quantitative real-time polymerase chain reaction(RT-qPCR)data normalisation.Commonly,in an unreliable way,several studies use genes involved in essential cellular functions[glyceraldehyde-3-phosphate dehydro-genase(GAPDH),18S rRNA,andβ-actin]without paying attention to whether they are suitable for such experimental conditions or the reason for choosing such genes.Furthermore,such studies use only one gene when Minimum Information for Publication of Quantitative Real-Time PCR Experiments guidelines recom-mend two or more genes.It impacts the credibility of these studies and causes dis-tortions in the gene expression findings.For tissue engineering,the accuracy of gene expression drives the best experimental or therapeutical approaches.We cultivated DPSCs under two conditions:Undifferentiated and osteogenic dif-ferentiation,both for 35 d.We evaluated the gene expression of 10 candidates for RGs[ribosomal protein,large,P0(RPLP0),TATA-binding protein(TBP),GAPDH,actin beta(ACTB),tubulin(TUB),aminolevulinic acid synthase 1(ALAS1),tyro-sine 3-monooxygenase/tryptophan 5-monooxygenase activation protein,zeta(YWHAZ),eukaryotic translational elongation factor 1 alpha(EF1a),succinate dehydrogenase complex,subunit A,flavoprotein(SDHA),and beta-2-micro-globulin(B2M)]every 7 d(1,7,14,21,28,and 35 d)by RT-qPCR.The data were analysed by the four main algorithms,ΔCt method,geNorm,NormFinder,and BestKeeper and ranked by the RefFinder method.We subdivided the samples into eight subgroups.RESULTS All of the data sets from clonogenic and osteogenic samples were analysed using the RefFinder algorithm.The final ranking showed RPLP0/TBP as the two most stable RGs and TUB/B2M as the two least stable RGs.Either theΔCt method or NormFinder analysis showed TBP/RPLP0 as the two most stable genes.However,geNorm analysis showed RPLP0/EF1αin the first place.These algorithms’two least stable RGs were B2M/GAPDH.For BestKeeper,ALAS1 was ranked as the most stable RG,and SDHA as the least stable RG.The pair RPLP0/TBP was detected in most subgroups as the most stable RGs,following the RefFinfer ranking.CONCLUSION For the first time,we show that RPLP0/TBP are the most stable RGs,whereas TUB/B2M are unstable RGs for long-term osteogenic differentiation of human DPSCs in traditional monolayers.
基金supported by the Major Program of National Agricultural Science and Technology of China(NK20220607)the West Light Foundation of the Chinese Academy of Sciences(2022XBZG_XBQNXZ_A_001)the Sichuan Science and Technology Program,China(2022ZDZX0014)。
文摘Grain weight is one of the key components of wheat(Triticum aestivum L.)yield.Genetic manipulation of grain weight is an efficient approach for improving yield potential in breeding programs.A recombinant inbred line(RIL)population derived from a cross between W7268 and Chuanyu 12(CY12)was employed to detect quantitative trait loci(QTLs)for thousand-grain weight(TGW),grain length(GL),grain width(GW),and the ratio of grain length to width(GLW)in six environments.Seven major QTLs,QGl.cib-2D,QGw.cib-2D,QGw.cib-3B,QGw.cib-4B.1,QGlw.cib-2D.1,QTgw.cib-2D.1 and QTgw.cib-3B.1,were consistently identified in at least four environments and the best linear unbiased estimation(BLUE)datasets,and they explained 2.61 to 34.85%of the phenotypic variance.Significant interactions were detected between the two major TGW QTLs and three major GW loci.In addition,QTgw.cib-3B.1 and QGw.cib-3B were co-located,and the improved TGW at this locus was contributed by GW.Unlike other loci,QTgw.cib-3B.1/QGw.cib-3B had no effect on grain number per spike(GNS).They were further validated in advanced lines using Kompetitive Allele Specific PCR(KASP)markers,and a comparison analysis indicated that QTgw.cib-3B.1/QGw.cib-3B is likely a novel locus.Six haplotypes were identified in the region of this QTL and their distribution frequencies varied between the landraces and cultivars.According to gene annotation,spatial expression patterns,ortholog analysis and sequence variation,the candidate gene of QTgw.cib-3B.1/QGw.cib-3B was predicted.Collectively,the major QTLs and KASP markers reported here provide valuable information for elucidating the genetic architecture of grain weight and for molecular marker-assisted breeding in grain yield improvement.
文摘Alzheimer’s disease is a progressive neurodegenerative disorder and the most common cause of dementia that principally affects older adults.Pathogenic factors,such as oxidative stress,an increase in acetylcholinesterase activity,mitochondrial dysfunction,genotoxicity,and neuroinflammation are present in this syndrome,which leads to neurodegeneration.Neurodegenerative pathologies such as Alzheimer’s disease are considered late-onset diseases caused by the complex combination of genetic,epigenetic,and environmental factors.There are two main types of Alzheimer’s disease,known as familial Alzheimer’s disease(onset<65 years)and late-onset or sporadic Alzheimer’s disease(onset≥65 years).Patients with familial Alzheimer’s disease inherit the disease due to rare mutations on the amyloid precursor protein(APP),presenilin 1 and 2(PSEN1 and PSEN2)genes in an autosomaldominantly fashion with closely 100%penetrance.In contrast,a different picture seems to emerge for sporadic Alzheimer’s disease,which exhibits numerous non-Mendelian anomalies suggesting an epigenetic component in its etiology.Importantly,the fundamental pathophysiological mechanisms driving Alzheimer’s disease are interfaced with epigenetic dysregulation.However,the dynamic nature of epigenetics seems to open up new avenues and hope in regenerative neurogenesis to improve brain repair in Alzheimer’s disease or following injury or stroke in humans.In recent years,there has been an increase in interest in using natural products for the treatment of neurodegenerative illnesses such as Alzheimer’s disease.Through epigenetic mechanisms,such as DNA methylation,non-coding RNAs,histone modification,and chromatin conformation regulation,natural compounds appear to exert neuroprotective effects.While we do not purport to cover every in this work,we do attempt to illustrate how various phytochemical compounds regulate the epigenetic effects of a few Alzheimer’s disease-related genes.
文摘Noncoding RNAs instruct the Cas9 nuclease to site speifillyl cleave DNA in the CRISPR/Cas9 system.Despite the high incidence of hepatocellular carcinoma(HCC),the patient's outcome is poor.As a result of the emergence of therapeutic resistance in HCC patients,dlinicians have faced difficulties in treating such tumor.In addition,CRISPR/Cas9 screens were used to identify genes that improve the dlinical response of HCC patients.It is the objective of this article to summarize the current understanding of the use of the CRISPR/Cas9 system for the treatment of cancer,with a particular emphasis on HCC as part of the current state of knowledge.Thus,in order to locate recent developments in oncology research,we examined both the Scopus database and the PubMed database.The ability to selectively interfere with gene expression in combinatorial CRISPR/Cas9 screening can lead to the discovery of new effective HCC treatment regimens by combining clinically approved drugs.Drug resistance can be overcome with the help of the CRISPR/Cas9 system.HCC signature genes and resistance to treatment have been uncovered by genome-scale CRISPR activation screening although this method is not without limitations.It has been extensively examined whether CRISPR can be used as a tool for disease research and gene therapy.CRISPR and its applications to tumor research,particularly in HCC,are examined in this study through a review of the literature.
基金supported by the National Key Research and Development Program of China (2021YFF0702201)National Natural Science Foundation of China (81873736,31872779,81830032)+2 种基金Guangzhou Key Research Program on Brain Science (202007030008)Department of Science and Technology of Guangdong Province (2021ZT09Y007,2020B121201006,2018B030337001,2021A1515012526)Natural Science Foundation of Guangdong Province (2021A1515012526,2022A1515012651)。
文摘Neurodegenerative diseases(NDs)are a group of debilitating neurological disorders that primarily affect elderly populations and include Alzheimer's disease(AD),Parkinson's disease(PD),Huntington's disease(HD),and amyotrophic lateral sclerosis(ALS).Currently,there are no therapies available that can delay,stop,or reverse the pathological progression of NDs in clinical settings.As the population ages,NDs are imposing a huge burden on public health systems and affected families.Animal models are important tools for preclinical investigations to understand disease pathogenesis and test potential treatments.While numerous rodent models of NDs have been developed to enhance our understanding of disease mechanisms,the limited success of translating findings from animal models to clinical practice suggests that there is still a need to bridge this translation gap.Old World nonhuman primates(NHPs),such as rhesus,cynomolgus,and vervet monkeys,are phylogenetically,physiologically,biochemically,and behaviorally most relevant to humans.This is particularly evident in the similarity of the structure and function of their central nervous systems,rendering such species uniquely valuable for neuroscience research.Recently,the development of several genetically modified NHP models of NDs has successfully recapitulated key pathologies and revealed novel mechanisms.This review focuses on the efficacy of NHPs in modeling NDs and the novel pathological insights gained,as well as the challenges associated with the generation of such models and the complexities involved in their subsequent analysis.
基金This study was supported by the National Key R&D Program of China(2021YFD1600200)Program of National Beef Cattle and Yak Industrial Technol-ogy System(NO.CARS-37)+1 种基金Natural Science Foundation of Sichuan Province(General Program)(24NSFSC0581)the Scientific and Technological Innovation Team for Qinghai-Tibetan Plateau Research in Southwest Minzu University(Grant No.2024CXTD02)。
文摘Background The genetic diversity of yak,a key domestic animal on the Qinghai-Tibetan Plateau(QTP),is a vital resource for domestication and breeding efforts.This study presents the first yak pangenome obtained through the de novo assembly of 16 yak genomes.Results We discovered 290 Mb of nonreference sequences and 504 new genes.Our pangenome-wide presence and absence variation(PAV)analysis revealed 5,120 PAV-related genes,highlighting a wide range of variety-specific genes and genes with varying frequencies across yak populations.Principal component analysis(PCA)based on binary gene PAV data classified yaks into three new groups:wild,domestic,and Jinchuan.Moreover,we pro-posed a‘two-haplotype genomic hybridization model'for understanding the hybridization patterns among breeds by integrating gene frequency,heterozygosity,and gene PAV data.A gene PAV-GWAS identified a novel gene(Bos-Gru3G009179)that may be associated with the multirib trait in Jinchuan yaks.Furthermore,an integrated transcrip-tome and pangenome analysis highlighted the significant differences in the expression of core genes and the muta-tional burden of differentially expressed genes between yaks from high and low altitudes.Transcriptome analysis across multiple species revealed that yaks have the most unique differentially expressed m RNAs and lnc RNAs(between high-and low-altitude regions),especially in the heart and lungs,when comparing high-and low-altitude adaptations.Conclusions The yak pangenome offers a comprehensive resource and new insights for functional genomic studies,supporting future biological research and breeding strategies.
基金Supported by National Natural Science Foundation of China,No.82100594.
文摘BACKGROUND Helicobacter pylori(H.pylori)infection is related to various extragastric diseases including type 2 diabetes mellitus(T2DM).However,the possible mechanisms connecting H.pylori infection and T2DM remain unknown.AIM To explore potential molecular connections between H.pylori infection and T2DM.METHODS We extracted gene expression arrays from three online datasets(GSE60427,GSE27411 and GSE115601).Differentially expressed genes(DEGs)commonly present in patients with H.pylori infection and T2DM were identified.Hub genes were validated using human gastric biopsy samples.Correlations between hub genes and immune cell infiltration,miRNAs,and transcription factors(TFs)were further analyzed.RESULTS A total of 67 DEGs were commonly presented in patients with H.pylori infection and T2DM.Five significantly upregulated hub genes,including TLR4,ITGAM,C5AR1,FCER1G,and FCGR2A,were finally identified,all of which are closely related to immune cell infiltration.The gene-miRNA analysis detected 13 miRNAs with at least two gene cross-links.TF-gene interaction networks showed that TLR4 was coregulated by 26 TFs,the largest number of TFs among the 5 hub genes.CONCLUSION We identified five hub genes that may have molecular connections between H.pylori infection and T2DM.This study provides new insights into the pathogenesis of H.pylori-induced onset of T2DM.
基金supported by the National Natural Science Foundation of China,No.81870975(to SZ)。
文摘Exosomes exhibit complex biological functions and mediate a variety of biological processes,such as promoting axonal regeneration and functional recove ry after injury.Long non-coding RNAs(IncRNAs)have been reported to play a crucial role in axonal regeneration.Howeve r,the role of the IncRNA-microRNAmessenger RNA(mRNA)-competitive endogenous RNA(ceRNA)network in exosome-mediated axonal regeneration remains unclear.In this study,we performed RNA transcriptome sequencing analysis to assess mRNA expression patterns in exosomes produced by cultured fibroblasts(FC-EXOs)and Schwann cells(SCEXOs).Diffe rential gene expression analysis,Gene Ontology analysis,Kyoto Encyclopedia of Genes and Genomes analysis,and protein-protein intera ction network analysis were used to explo re the functions and related pathways of RNAs isolated from FC-EXOs and SC-EXOs.We found that the ribosome-related central gene Rps5 was enriched in FC-EXOs and SC-EXOs,which suggests that it may promote axonal regeneration.In addition,using the miRWalk and Starbase prediction databases,we constructed a regulatory network of ceRNAs targeting Rps5,including 27 microRNAs and five IncRNAs.The ceRNA regulatory network,which included Ftx and Miat,revealed that exsosome-derived Rps5 inhibits scar formation and promotes axonal regeneration and functional recovery after nerve injury.Our findings suggest that exosomes derived from fibro blast and Schwann cells could be used to treat injuries of peripheral nervous system.
基金supported by the Jiangsu Natural Science Foundation,China(BK20231468)the Fundamental Research Funds for the Central Universities,China(ZJ24195012)+3 种基金the National Natural Science Foundation in China(31871668)the Jiangsu Key R&D Program,China(BE2022384)the Xinjiang Uygur Autonomous Region Science and Technology Support Program,China(2021E02003)the Jiangsu Collaborative Innovation Center for Modern Crop Production Project,China(No.10)。
文摘Root system architecture plays an essential role in water and nutrient acquisition in plants,and it is significantly involved in plant adaptations to various environmental stresses.In this study,a panel of 242 cotton accessions was collected to investigate six root morphological traits at the seedling stage,including main root length(MRL),root fresh weight(RFW),total root length(TRL),root surface area(RSA),root volume(RV),and root average diameter(AvgD).The correlation analysis of the six root morphological traits revealed strong positive correlations of TRL with RSA,as well as RV with RSA and AvgD,whereas a significant negative correlation was found between TRL and AvgD.Subsequently,a genome-wide association study(GWAS)was performed using the root phenotypic and genotypic data reported previously for the 242 accessions using 56,010 single nucleotide polymorphisms(SNPs)from the CottonSNP80K array.A total of 41 quantitative trait loci(QTLs)were identified,including nine for MRL,six for RFW,nine for TRL,12 for RSA,12 for RV and two for AvgD.Among them,eight QTLs were repeatedly detected in two or more traits.Integrating these results with a transcriptome analysis,we identified 17 candidate genes with high transcript values of transcripts per million(TPM)≥30 in the roots.Furthermore,we functionally verified the candidate gene GH_D05G2106,which encodes a WPP domain protein 2in root development.A virus-induced gene silencing(VIGS)assay showed that knocking down GH_D05G2106significantly inhibited root development in cotton,indicating its positive role in root system architecture formation.Collectively,these results provide a theoretical basis and candidate genes for future studies on cotton root developmental biology and root-related cotton breeding.
基金supported by the Notional Natural Science Foundation of China,No.81960417 (to JX)Guangxi Key Research and Development Program,No.GuiKeA B20159027 (to JX)the Natural Science Foundation of Guangxi Zhuang Autonomous Region,No.2022GXNSFBA035545 (to YG)。
文摘Immune changes and inflammatory responses have been identified as central events in the pathological process of spinal co rd injury.They can greatly affect nerve regeneration and functional recovery.However,there is still limited understanding of the peripheral immune inflammato ry response in spinal cord inju ry.In this study.we obtained microRNA expression profiles from the peripheral blood of patients with spinal co rd injury using high-throughput sequencing.We also obtained the mRNA expression profile of spinal cord injury patients from the Gene Expression Omnibus(GEO)database(GSE151371).We identified 54 differentially expressed microRNAs and 1656 diffe rentially expressed genes using bioinformatics approaches.Functional enrichment analysis revealed that various common immune and inflammation-related signaling pathways,such as neutrophil extracellular trap formation pathway,T cell receptor signaling pathway,and nuclear factor-κB signal pathway,we re abnormally activated or inhibited in spinal cord inju ry patient samples.We applied an integrated strategy that combines weighted gene co-expression network analysis,LASSO logistic regression,and SVM-RFE algorithm and identified three biomarke rs associated with spinal cord injury:ANO10,BST1,and ZFP36L2.We verified the expression levels and diagnostic perfo rmance of these three genes in the original training dataset and clinical samples through the receiver operating characteristic curve.Quantitative polymerase chain reaction results showed that ANO20 and BST1 mRNA levels were increased and ZFP36L2 mRNA was decreased in the peripheral blood of spinal cord injury patients.We also constructed a small RNA-mRNA interaction network using Cytoscape.Additionally,we evaluated the proportion of 22 types of immune cells in the peripheral blood of spinal co rd injury patients using the CIBERSORT tool.The proportions of naive B cells,plasma cells,monocytes,and neutrophils were increased while the proportions of memory B cells,CD8^(+)T cells,resting natural killer cells,resting dendritic cells,and eosinophils were markedly decreased in spinal cord injury patients increased compared with healthy subjects,and ANO10,BST1 and ZFP26L2we re closely related to the proportion of certain immune cell types.The findings from this study provide new directions for the development of treatment strategies related to immune inflammation in spinal co rd inju ry and suggest that ANO10,BST2,and ZFP36L2 are potential biomarkers for spinal cord injury.The study was registe red in the Chinese Clinical Trial Registry(registration No.ChiCTR2200066985,December 12,2022).
文摘●AIM:To investigate the molecular diagnosis of a threegeneration Chinese family affected with aniridia,and further to identify clinically a PAX6 missense mutation in members with atypical aniridia.●METHODS:Eleven family members with and without atypical aniridia were recruited.All family members underwent comprehensive ophthalmic examinations.A combination of whole exome sequencing(WES)and direct Sanger sequencing were performed to uncover the causative mutation.●RESULTS:Among the 11 family members,8 were clinically diagnosed with congenital aniridia(atypical aniridia phenotype).A rare heterozygous mutation c.622C>T(p.Arg208Trp)in exon 8 of PAX6 was identified in all affected family members but not in the unaffected members or in healthy control subjects.●CONCLUSION:A rare missense mutation in the PAX6 gene is found in members of a three-generation Chinese family with congenital atypical aniridia.This result contributes to an increase in the phenotypic spectrum caused by PAX6 missense heterozygous variants and provides useful information for the clinical diagnosis of atypical aniridia,which may also contribute to genetic counselling and family planning.
基金supported by grants from the Major Program of National Agricultural Science and Technology of China(NK20220607)the National Natural Science Foundation of China(32272059 and 31971883)the Science and Technology Department of Sichuan Province(2021YFYZ0002,2022ZDZX0014,and 2023NSFSC1995)。
文摘Stripe rust,caused by Puccinia striiformis f.sp.tritici(Pst),is a devastating disease in wheat worldwide.Discovering and characterizing new resistance genes/QTL is crucial for wheat breeding programs.In this study,we fine-mapped and characterized a stripe rust resistance gene,YRAYH,on chromosome arm 5BL in the Chinese wheat landrace Anyuehong(AYH).Evaluations of stripe rust response to prevalent Chinese Pst races in near-isogenic lines derived from a cross of Anyuehong and Taichung 29 showed that YrAYH conferred a high level of resistance at all growth stages.Fine mapping using a large segregating population of 9748 plants,narrowed the YRAYH locus to a 3.7 Mb interval on chromosome arm 5BL that included 61 annotated genes.Transcriptome analysis of two NIL pairs identified 64 upregulated differentially expressed genes(DEGs)in the resistant NILs(NILs-R).Annotations indicated that many of these genes have roles in plant disease resistance pathways.Through a combined approach of fine-mapping and transcriptome sequencing,we identified a serine/threonine-protein kinase SRPK as a candidate gene underlying YrAYH.A unique 25 bp insertion was identified in the NILs-R compared to the NILs-S and previously published wheat genomes.An InDel marker was developed and co-segregated with YrAYH.Agronomic trait evaluation of the NILs suggested that YrAYH not only reduces the impact of stripe rust but was also associated with a gene that increases plant height and spike length.
基金supported by the National Key Research and Development Program of China(2022YFD1200300)the Central Plain Scholar Program,China(234000510004)the National Supercomputing Center in Zhengzhou,China。
文摘Cotton fiber quality is a persistent concern that determines planting benefits and the quality of finished textile products.However,the limitations of measurement instruments have hindered the accurate evaluation of some important fiber characteristics such as fiber maturity,fineness,and neps,which in turn has impeded the genetic improvement and industrial utilization of cotton fiber.Here,12 single fiber quality traits were measured using Advanced Fiber Information System(AFIS)equipment among 383 accessions of upland cotton(Gossypium hirsutum L.).In addition,eight conventional fiber quality traits were assessed by the High Volume Instrument(HVI)System.Genome-wide association study(GWAS),linkage disequilibrium(LD)block genotyping and functional identification were conducted sequentially to uncover the associated elite loci and candidate genes of fiber quality traits.As a result,the previously reported pleiotropic locus FL_D11 regulating fiber length-related traits was identified in this study.More importantly,three novel pleiotropic loci(FM_A03,FF_A05,and FN_A07)regulating fiber maturity,fineness and neps,respectively,were detected based on AFIS traits.Numerous highly promising candidate genes were screened out by integrating RNA-seq and qRT-PCR analyses,including the reported GhKRP6 for fiber length,the newly identified GhMAP8 for maturity and GhDFR for fineness.The origin and evolutionary analysis of pleiotropic loci indicated that the selection pressure on FL_D11,FM_A03 and FF_A05 increased as the breeding period approached the present and the origins of FM_A03 and FF_A05 were traced back to cotton landraces.These findings reveal the genetic basis underlying fiber quality and provide insight into the genetic improvement and textile utilization of fiber in G.hirsutum.
基金supported by the National Key Research and Development Program of China(2022YFD1200300)the National Natural Science Foundation of China(32072376 and 32372515)+3 种基金Winall Hi-tech Seed Co.,Ltd.,China(GMLM2023)the Nanfan Special Project of Chinese Academy of Agricultural Sciences(CAAS)(ZDXM2303 and YBXM2415)the Natural Science Foundation of Hebei Province,China(C2022204205)the Agricultural Science and Technology Innovation Program of CAAS。
文摘Verticillium wilt(VW),induced by the soil-borne fungus Verticillium dahliae(Vd),poses a substantial threat to a diverse array of plant species.Employing molecular breeding technology for the development of cotton varieties with heightened resistance to VW stands out as one of the most efficacious protective measures.In this study,we successfully generated two stable transgenic lines of cotton(Gossypium hirsutum L.),VdThitRNAi-1 and VdThit-RNAi-2,using host-induced gene silencing(HIGS)technology to introduce double-stranded RNA(dsRNA)targeting the thiamine transporter protein gene(VdThit).Southern blot analysis confirmed the presence of a single-copy insertion in each line.Microscopic examination showed marked reductions in the colonization and spread of Vd-mCherry in the roots of VdThit-RNAi cotton compared to wild type(WT).The corresponding disease index and fungal biomass of VdThit-RNAi-1/2 also exhibited significant reductions.Real-time quantitative PCR(qRT-PCR)analysis demonstrated a substantial inhibition of VdThit expression following prolonged inoculation of VdThit-RNAi cotton.Small RNA sequencing(sRNA-Seq)analysis revealed the generation of a substantial number of VdThit-specific siRNAs in the VdThit-RNAi transgenic lines.Additionally,the silencing of VdThit by the siVdThit produced by VdThit-RNAi-1/2 resulted in the elevated expression of multiple genes involved in the thiamine biosynthesis pathway in Vd.Under field conditions,VdThit-RNAi transgenic cotton exhibited significantly enhanced disease resistance and yield compared with WT.In summary,our findings underscore the efficacy of HIGS targeting VdThit in restraining the infection and spread of Vd in cotton,thereby potentially enabling the development of cotton breeding as a promising strategy for managing VW.
基金supported by the Fujian Province Seed Industry Innovation and Industrialization Project“Innovation and Industrialization Development of Precious Tree Seed Industries(Phoebe bornei)”(ZYCX-LY-202102)the Sub-project of National Key R&D Program“Phoebe bornei Efficient Cultivation Technology”(2016YFD0600603-2).
文摘Heat shock transcription factors(Hsfs)have important roles during plant growth and development and responses to abiotic stresses.The identification and func-tion of Hsf genes have been thoroughly studied in various herbaceous plant species,but not woody species,especially Phoebe bournei,an endangered,unique species in China.In this study,17 members of the Hsf gene family were identi-fied from P.bournei using bioinformatic methods.Phyloge-netic analysis indicated that PbHsf genes were grouped into three subfamilies:A,B,and C.Conserved motifs,three-dimensional structure,and physicochemical properties of the PbHsf proteins were also analyzed.The structure of the PbHsf genes varied in the number of exons and introns.Pre-diction of cis-acting elements in the promoter region indi-cated that PbHsf genes are likely involved in responses to plant hormones and stresses.A collinearity analysis dem-onstrated that expansions of the PbHsf gene family mainly take place via segmental duplication.The expression levels of PbHsf genes varied across different plant tissues.On the basis of the expression profiles of five representative PbHsf genes during heat,cold,salt,and drought stress,PbHsf pro-teins seem to have multiple functions depending on the type of abiotic stress.This systematic,genome-wide investigation of PbHsf genes in P.bournei and their expression patterns provides valuable insights and information for further func-tional dissection of Hsf proteins in this endangered,unique species.