[Objective] The aims were to investigate the screening and identification of amylase-producing marine bacteria from Arctic sea and the optimization of the amylase producing conditions. [Method] A high-yield strain for...[Objective] The aims were to investigate the screening and identification of amylase-producing marine bacteria from Arctic sea and the optimization of the amylase producing conditions. [Method] A high-yield strain for producing amylase named ArcB84A was isolated from a total of 156 marine bacteria of Arctic sea. Then,the morphological identification of the strain,molecular identification of 16S rRNA and optimization of fermentation conditions were conducted. [Result] ArcB84A strain was a member of Pseudoalteromonas genus. The optimum conditions for enzyme production of B84A strain included that,the initial pH value of the medium was 7.0-8.0,and the best carbon and nitrogen sources respectively were 5‰ glucose and peptone. Surfactants including TritonX-100,Tween20 and Tween80 could increase amylase activity of the strain,in which,the effect of 10‰ Tween80 was the most obvious.展开更多
Starch degradation in cells is closely associated with cereal seed germination, photosynthesis in leaves, carbohydrate storage in tuberous roots, and fleshy fruit development. α_Amylase is considered as one of the ke...Starch degradation in cells is closely associated with cereal seed germination, photosynthesis in leaves, carbohydrate storage in tuberous roots, and fleshy fruit development. α_Amylase is considered as one of the key enzymes catalyzing starch breakdown, but up to date its role in starch breakdown in living cells remains unclear because the enzyme was often shown extrachloroplastic in living cells. The present experiment showed that α_amylase activity was progressively increasing concomitantly with the decreasing starch concentrations during the development of apple ( Malus domestica Borkh cv. Starkrimson) fruit. The apparent amount of α_amylase assessed by Western blotting also increased during the fruit development, which is consistent with the seasonal changes in the enzyme activity. The enzyme subcellular_localization studies via immunogold electron_ microscopy technique showed that α_amylase visualized by gold particles was predominantly located in plastids, but the gold particles were scarcely found in other subcellular compartments. A high density of the enzyme was observed at the periphery of starch granules during the middle and late developmental stages. These data proved that the enzyme is compartmented in its functional sites in the living cells of the fruit. The predominantly plastid_distributed pattern of α_amylase in cells was shown unchanged throughout the fruit development. The density of gold particles (α_amylase) in plastids was increasing during the fruit development, which is consistent with the results of Western blotting. So it is considered that α_amylase is involved in starch hydrolysis in plastids of the fruit cells.展开更多
Objective] The aim of this study was to investigate the effects of exoge-nous amylases and Ca2＋, Mn2＋ and K＋ on the amylase specific activities and starch degradation of the upper leaves of ＇KRK26＇ planted in Yun...Objective] The aim of this study was to investigate the effects of exoge-nous amylases and Ca2＋, Mn2＋ and K＋ on the amylase specific activities and starch degradation of the upper leaves of ＇KRK26＇ planted in Yunnan Province during flue-curing. [Method] The amylase specific activities and starch degradation of the leaves were determined by using spectrophotometry. [Result] The 8 U/g exogenous α-amy-lase could improve the specific activity of the leaf α-amylase at yel owing and color-fixing stages, but could not at stem-drying stage, and similarly, the 80 U/g exoge-nous β-amylase could improved the specific activity of the leaf β-amylase at the yel owing stage and the early period of color-fixing stage. The leaf starch could be enhanced to degrade by the exogenous α- or β-amylases and the enhancing effect of the former was stronger than that of the later. 1.50 mg/ml Ca2＋ improved the specific activity of the leaf （α＋β）-amylase mainly due to its enhancing effect on the leaf α-amylase, and increased the starch degradation. 4 mmol/L Mn2＋ inhibited the leaf α-amylase from yel owing to the early period of color-fixing and the β- and （α＋β）-amylases from the yel owing to the later period of color-fixing, but enhanced the leafα-amylase from the later period of color-fixing to the later period of stem-drying and the β- and （α＋β）-amylases at the later period of stem-drying. Meanwhile, Mn2＋ ham-pered the starch degradation during yel owing, but promoted it from the early period of color-fixing to stem-drying. 1 mg/ml K＋ enhanced the leaf α-, β- and （α＋β）-amy-lases during the yel owing stage, but lowered them from the early period of color-fix-ing to the later period of stem-drying, and always inhibited the leaf starch degrada-tion. [Conclusion] The exogenous α-, β- amylases and Ca2＋ of suitable concentra-tions could be used to treat the tobacco leaves before flue-curing to improve the leaf starch degradation during the curing.展开更多
Starch degradation in cells is closely associated with cereal seed germination, photosynthesis in leaves, carbohydrate storage in tuber and tuberous roots, and fleshy fruit development. Based on previously reported ...Starch degradation in cells is closely associated with cereal seed germination, photosynthesis in leaves, carbohydrate storage in tuber and tuberous roots, and fleshy fruit development. Based on previously reported in vitro assays, β amylase is considered as one of the key enzymes catalyzing starch breakdown, but up to date its role in starch breakdown in living cells remains unclear because the enzyme was shown often extrachloroplastic in living cells. Recently we have shown for the first time that β_amylase is predominantly immuno_localized to plastids in living cells of developing apple fruit. But it remains to know whether this model of β_amylase compartmentation is more widespread in plant living cells. The present experiment, conducted in tuberous root of sweet potato ( Ipomea batatas Lam. cv. Xushu 18) and via immunogold electron_microscopy technique, showed that β amylase visualized by gold particles was predominantly localized in plastids especially at periphery of starch granules, but the gold particles were scarcely found in other subcellular compartments, indicating that the enzyme is subcellularly compartmented in the same zone as its starch substrates. The density of gold particles (β amylase) in plastids was increasing during growing season, but the predominantly plastid_distributed pattern of β amylase in cells was shown unchanged throughout the tuberous root development. These data prove that the enzyme is compartmented in its functional sites, and so provide evidence to support the possible widespread biological function of the enzyme in catalyzing starch breakdown in plant living cells or at least in living cells of plant storage organs.展开更多
The changes in the activity of amylase and amylase-isoenzyme and the degradation of starch and pigment of tobacco leaf during flue-curing were studied by using the electric- heated flue-curing barn designed and made...The changes in the activity of amylase and amylase-isoenzyme and the degradation of starch and pigment of tobacco leaf during flue-curing were studied by using the electric- heated flue-curing barn designed and made by the Henan Agricultural University. The temperature and humidity of the barn were controlled automatically. The results indicated that starch in tobacco leaf decreased rapidly and leveled off after 48 h of curring, in the meantime, the content of soluble sugar increased accordingly and reached a peak at the stage of color-fixing. Both of them had a rapid-changing stage in the first 36 hours of yellowing. The changes of starch and soluble sugar contents had highly significant negative-correlation at 1 % level (rNC89 = -0.8962**, rYY85 = -0.9704**). The activity of amylase increased with the proceeding of curing and reached a peak after 36 hours of curing, then decreased. But the activity of amylase kept at a high level when the humidity of curing-environment was very low, even if the tobacco leaf had been dried. The rapid degradation of starch showed a significantly negative correlation with the increase of activity of amylase at 5 % level (rNC89 = -0.8495*, rYY85 = -0.7839*). The degradation of starch and pigment had the same regulation and had highly significant correlation at 1 % level (rNC89= 0.9649**, rYY85= 0.9428**). There were mainly three amylase-isoenzyme bands -A, B, C respectively, in tobacco leaf during flue curing. They were identified as α-AMY, β-AMY, R-AMY, and the activity of β-AMY was the highest. The changes in amylase activity and contents of starch and pigment were affected by the tobacco leaf moisture and environmental humidity during curing.展开更多
Postprandial hyperglycemia is an early indication of type 2 diabetes and the target of many anti-diabetic and anti-obesity studies.α-Glucosidase and α-amylase are the crucial factors in regulating starch digestion a...Postprandial hyperglycemia is an early indication of type 2 diabetes and the target of many anti-diabetic and anti-obesity studies.α-Glucosidase and α-amylase are the crucial factors in regulating starch digestion and glucose absorption,making them key targets for many studies to treat postprandial hyperglycemia.We studied the inhibitory activities of microalgal fucoxanthin against rat-intestinalα-glucosidase and pancreaticα-amylase along with the antidiabetic eff ect to induce diff erentiation in 3T3-L1 pre-adipocytes using Oil Red-O staining.Fucoxanthin displayed strong hindrance activities towardα-amylase in a concentration-dependent manner,with an IC50 value of 0.68mmol/L,whereas weak inhibitory activity against α-glucosidase,with an IC 50 value of 4.75 mmol/L.Fucoxanthin also considerably elevated glucose oxidase activity in 3T3-L1 cells by 31.3%at 5μmol/L.During adipocyte differentiation,fucoxanthin showed lipid accumulation in 3T3-L1 cells with no cytotoxicity up to 20μmol/L.However,fucoxanthin had no inhibitory activity on glucose-6-phosphate dehydrogenase.These results suggest that fucoxanthin might be useful for the prevention of obesity or diabetes by inhibiting carbohydrate-hydrolyzing enzymes and lipid accumulation and be utilized as an ingredient for a functional food or dietary supplement.展开更多
A novel mesophilic bacterial amylase, named oligosaccharide-producing multifunctional amylase（OPMA）, was discovered and characterized. OPMA is an extracellular enzyme secreted by ZW253 1-1, a strain newly isolated f...A novel mesophilic bacterial amylase, named oligosaccharide-producing multifunctional amylase（OPMA）, was discovered and characterized. OPMA is an extracellular enzyme secreted by ZW253 1-1, a strain newly isolated from Chinese soil. It could be purified to homogeneity from the culture supernatant of ZW2531-1 by 30%-60% saturated ammonium sulfate precipitation, followed by twice Sephadex gel filtration chromatography. OPMA is a 66 kDa protein based on SDS-PAGE and has an isoelectric point（p/） at pH=5.3 by Isoelectric focusing electrophoresis（WE）. It only catalyzes the degradation of starch, rather than other alpha-l,4- and/or 1,6-glucan polysaccbarides such as fl-cyclomaltodextrin and pullulan. OPMA degraded starch to produce several oligosccharides including maltose, maltotriose, and isomaltotriose as the major end-products, and perhaps other oligosaccharides such as isomalto- tetraose, rather than glucose. OPMA exhibited optimal catalytic activity at a reaction temperature of 50 ℃ and pH=6.0, as determined by orthogonal test. Under the optimal reaction conditions, purified OPMA bad a specific activity of 13.75 U/rag. These findings suggest that OPMA could be used for the production of some oligosaccharides beneficial to the food industry and medicine.展开更多
AIM To estimate the efficacy of 2 h post-endoscopic retrograde cholangiopancreatography(ERCP) serum amylase levels and other factors for predicting postERCP pancreatitis.METHODS This was a retrospective,single-center ...AIM To estimate the efficacy of 2 h post-endoscopic retrograde cholangiopancreatography(ERCP) serum amylase levels and other factors for predicting postERCP pancreatitis.METHODS This was a retrospective,single-center cohort study of consecutive patients who underwent ERCP from January 2010 to December 2013.Serum amylase levels were measured 2 h post-procedure,and patient- and procedure-related pancreatitis(PEP) risk factors wereanalyzed using a logistic model.RESULTS A total of 1520 cases(average age 72 ± 12 years,60% male) were initially enrolled in this study,and 1403 cases(725 patients) were ultimately analyzed after the exclusion of 117 cases.Fifty-five of these cases developed PEP.We established a 2 h serum amylase cutoff level of two times the upper limit of normal for predicting PEP.Multivariate analysis revealed that a cannulation time of more than 13 min [odds ratio(OR) 2.28,95%CI:1.132-4.651,P=0.0210] and 2 h amylase levels greater than the cutoff level(OR=24.1,95%CI:11.56-57.13,P<0.0001) were significant predictive factors for PEP.Forty-seven of the 55 patients who developed PEP exhibited 2 h amylase levels greater than the cutoff level(85%),and six of the remaining eight patients who developed PEP(75%) required longer cannulation times.Only 2 of the 1403 patients(0.14%) who developed PEP did not exhibit concerning 2 h amylase levels or require longer cannulation times.CONCLUSION These findings indicate that the combination of 2 h post-ERCP serum amylase levels and cannulation times represents a valuable marker for identifying patients at high risk for PEP.展开更多
AIM: To clarify the relationship between the change of serum amylase level and post-ERCP pancreatitis. METHODS: Between January 1999 and December 2002, 1291 ERCP-related procedures were performed. Serum amylase concen...AIM: To clarify the relationship between the change of serum amylase level and post-ERCP pancreatitis. METHODS: Between January 1999 and December 2002, 1291 ERCP-related procedures were performed. Serum amylase concentrations were measured before the procedure and 3, 6, and 24 h afterward. The frequency and severity of post-ERCP pancreatitis and the relationship between these phenomena and the change in amylase level were estimated. RESULTS: Post-ERCP pancreatitis occurred in 47 patients (3.6%). Pancreatitis occurred in 1% of patients with normal amylase levels 3 h after ERCP, and in 1%, 5%, 20%, 31% and 39% of patients with amylase levels elevated 1-2 times, 2-3 times, 3-5 times, 5-10 times and over 10 times the upper normal limit at 3 h after ERCP, respectively (level < 2 times vs ≥ 2 times, P < 0.001). Of the 143 patients with levels higher than the normal limit at 3 h after ERCP followed by elevation at 6 h, pancreatitis occurred in 26%. In contrast, pancreatitis occurred in 9% of 45 patients with a level higher than two times the normal limit at 3 h after ERCP followed by a decrease at 6 h (26% vs 9%, P < 0.05). CONCLUSION: Post-ERCP pancreatitis is frequently associated with an increase in serum amylase level greater than twice the normal limit at 3 h after ERCP with an elevation at 6 h. A decrease in amylase level at 6 h after ERCP suggests the unlikelihood of development of post-ERCP pancreatitis.展开更多
This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
基金Supported by International S&T Cooperation Program of China (No.2007DFA21300)Open Research Fund Program of the Ningbo Key Laboratory (No.2007A22007)+1 种基金Zhejiang Xinmiao Excellent Talents Program (No.2008R40G2210031)Education of Zhejiang Province Program (No.20060190)~~
文摘[Objective] The aims were to investigate the screening and identification of amylase-producing marine bacteria from Arctic sea and the optimization of the amylase producing conditions. [Method] A high-yield strain for producing amylase named ArcB84A was isolated from a total of 156 marine bacteria of Arctic sea. Then,the morphological identification of the strain,molecular identification of 16S rRNA and optimization of fermentation conditions were conducted. [Result] ArcB84A strain was a member of Pseudoalteromonas genus. The optimum conditions for enzyme production of B84A strain included that,the initial pH value of the medium was 7.0-8.0,and the best carbon and nitrogen sources respectively were 5‰ glucose and peptone. Surfactants including TritonX-100,Tween20 and Tween80 could increase amylase activity of the strain,in which,the effect of 10‰ Tween80 was the most obvious.
文摘Starch degradation in cells is closely associated with cereal seed germination, photosynthesis in leaves, carbohydrate storage in tuberous roots, and fleshy fruit development. α_Amylase is considered as one of the key enzymes catalyzing starch breakdown, but up to date its role in starch breakdown in living cells remains unclear because the enzyme was often shown extrachloroplastic in living cells. The present experiment showed that α_amylase activity was progressively increasing concomitantly with the decreasing starch concentrations during the development of apple ( Malus domestica Borkh cv. Starkrimson) fruit. The apparent amount of α_amylase assessed by Western blotting also increased during the fruit development, which is consistent with the seasonal changes in the enzyme activity. The enzyme subcellular_localization studies via immunogold electron_ microscopy technique showed that α_amylase visualized by gold particles was predominantly located in plastids, but the gold particles were scarcely found in other subcellular compartments. A high density of the enzyme was observed at the periphery of starch granules during the middle and late developmental stages. These data proved that the enzyme is compartmented in its functional sites in the living cells of the fruit. The predominantly plastid_distributed pattern of α_amylase in cells was shown unchanged throughout the fruit development. The density of gold particles (α_amylase) in plastids was increasing during the fruit development, which is consistent with the results of Western blotting. So it is considered that α_amylase is involved in starch hydrolysis in plastids of the fruit cells.
基金Supported by Fund from Yunnan Academy of Tobacco Agricultural Sciences for Comparative Study of the Flue-cured Tobaccos of the New Tobacco-growing Areas in Yunnan Province and Those of Zimbabwe(09YN001)~~
文摘Objective] The aim of this study was to investigate the effects of exoge-nous amylases and Ca2＋, Mn2＋ and K＋ on the amylase specific activities and starch degradation of the upper leaves of ＇KRK26＇ planted in Yunnan Province during flue-curing. [Method] The amylase specific activities and starch degradation of the leaves were determined by using spectrophotometry. [Result] The 8 U/g exogenous α-amy-lase could improve the specific activity of the leaf α-amylase at yel owing and color-fixing stages, but could not at stem-drying stage, and similarly, the 80 U/g exoge-nous β-amylase could improved the specific activity of the leaf β-amylase at the yel owing stage and the early period of color-fixing stage. The leaf starch could be enhanced to degrade by the exogenous α- or β-amylases and the enhancing effect of the former was stronger than that of the later. 1.50 mg/ml Ca2＋ improved the specific activity of the leaf （α＋β）-amylase mainly due to its enhancing effect on the leaf α-amylase, and increased the starch degradation. 4 mmol/L Mn2＋ inhibited the leaf α-amylase from yel owing to the early period of color-fixing and the β- and （α＋β）-amylases from the yel owing to the later period of color-fixing, but enhanced the leafα-amylase from the later period of color-fixing to the later period of stem-drying and the β- and （α＋β）-amylases at the later period of stem-drying. Meanwhile, Mn2＋ ham-pered the starch degradation during yel owing, but promoted it from the early period of color-fixing to stem-drying. 1 mg/ml K＋ enhanced the leaf α-, β- and （α＋β）-amy-lases during the yel owing stage, but lowered them from the early period of color-fix-ing to the later period of stem-drying, and always inhibited the leaf starch degrada-tion. [Conclusion] The exogenous α-, β- amylases and Ca2＋ of suitable concentra-tions could be used to treat the tobacco leaves before flue-curing to improve the leaf starch degradation during the curing.
文摘Starch degradation in cells is closely associated with cereal seed germination, photosynthesis in leaves, carbohydrate storage in tuber and tuberous roots, and fleshy fruit development. Based on previously reported in vitro assays, β amylase is considered as one of the key enzymes catalyzing starch breakdown, but up to date its role in starch breakdown in living cells remains unclear because the enzyme was shown often extrachloroplastic in living cells. Recently we have shown for the first time that β_amylase is predominantly immuno_localized to plastids in living cells of developing apple fruit. But it remains to know whether this model of β_amylase compartmentation is more widespread in plant living cells. The present experiment, conducted in tuberous root of sweet potato ( Ipomea batatas Lam. cv. Xushu 18) and via immunogold electron_microscopy technique, showed that β amylase visualized by gold particles was predominantly localized in plastids especially at periphery of starch granules, but the gold particles were scarcely found in other subcellular compartments, indicating that the enzyme is subcellularly compartmented in the same zone as its starch substrates. The density of gold particles (β amylase) in plastids was increasing during growing season, but the predominantly plastid_distributed pattern of β amylase in cells was shown unchanged throughout the tuberous root development. These data prove that the enzyme is compartmented in its functional sites, and so provide evidence to support the possible widespread biological function of the enzyme in catalyzing starch breakdown in plant living cells or at least in living cells of plant storage organs.
文摘The changes in the activity of amylase and amylase-isoenzyme and the degradation of starch and pigment of tobacco leaf during flue-curing were studied by using the electric- heated flue-curing barn designed and made by the Henan Agricultural University. The temperature and humidity of the barn were controlled automatically. The results indicated that starch in tobacco leaf decreased rapidly and leveled off after 48 h of curring, in the meantime, the content of soluble sugar increased accordingly and reached a peak at the stage of color-fixing. Both of them had a rapid-changing stage in the first 36 hours of yellowing. The changes of starch and soluble sugar contents had highly significant negative-correlation at 1 % level (rNC89 = -0.8962**, rYY85 = -0.9704**). The activity of amylase increased with the proceeding of curing and reached a peak after 36 hours of curing, then decreased. But the activity of amylase kept at a high level when the humidity of curing-environment was very low, even if the tobacco leaf had been dried. The rapid degradation of starch showed a significantly negative correlation with the increase of activity of amylase at 5 % level (rNC89 = -0.8495*, rYY85 = -0.7839*). The degradation of starch and pigment had the same regulation and had highly significant correlation at 1 % level (rNC89= 0.9649**, rYY85= 0.9428**). There were mainly three amylase-isoenzyme bands -A, B, C respectively, in tobacco leaf during flue curing. They were identified as α-AMY, β-AMY, R-AMY, and the activity of β-AMY was the highest. The changes in amylase activity and contents of starch and pigment were affected by the tobacco leaf moisture and environmental humidity during curing.
基金a part of the project titled ’Future Marine Technology Development’ funded by the Ministry of Oceans and Fisheries, Republic of Korea
文摘Postprandial hyperglycemia is an early indication of type 2 diabetes and the target of many anti-diabetic and anti-obesity studies.α-Glucosidase and α-amylase are the crucial factors in regulating starch digestion and glucose absorption,making them key targets for many studies to treat postprandial hyperglycemia.We studied the inhibitory activities of microalgal fucoxanthin against rat-intestinalα-glucosidase and pancreaticα-amylase along with the antidiabetic eff ect to induce diff erentiation in 3T3-L1 pre-adipocytes using Oil Red-O staining.Fucoxanthin displayed strong hindrance activities towardα-amylase in a concentration-dependent manner,with an IC50 value of 0.68mmol/L,whereas weak inhibitory activity against α-glucosidase,with an IC 50 value of 4.75 mmol/L.Fucoxanthin also considerably elevated glucose oxidase activity in 3T3-L1 cells by 31.3%at 5μmol/L.During adipocyte differentiation,fucoxanthin showed lipid accumulation in 3T3-L1 cells with no cytotoxicity up to 20μmol/L.However,fucoxanthin had no inhibitory activity on glucose-6-phosphate dehydrogenase.These results suggest that fucoxanthin might be useful for the prevention of obesity or diabetes by inhibiting carbohydrate-hydrolyzing enzymes and lipid accumulation and be utilized as an ingredient for a functional food or dietary supplement.
基金Supported by the National High Technology Research and Development Program of China(No.2007AA100601-2)the National Natural Science Foundation of China(No.30870518).
文摘A novel mesophilic bacterial amylase, named oligosaccharide-producing multifunctional amylase（OPMA）, was discovered and characterized. OPMA is an extracellular enzyme secreted by ZW253 1-1, a strain newly isolated from Chinese soil. It could be purified to homogeneity from the culture supernatant of ZW2531-1 by 30%-60% saturated ammonium sulfate precipitation, followed by twice Sephadex gel filtration chromatography. OPMA is a 66 kDa protein based on SDS-PAGE and has an isoelectric point（p/） at pH=5.3 by Isoelectric focusing electrophoresis（WE）. It only catalyzes the degradation of starch, rather than other alpha-l,4- and/or 1,6-glucan polysaccbarides such as fl-cyclomaltodextrin and pullulan. OPMA degraded starch to produce several oligosccharides including maltose, maltotriose, and isomaltotriose as the major end-products, and perhaps other oligosaccharides such as isomalto- tetraose, rather than glucose. OPMA exhibited optimal catalytic activity at a reaction temperature of 50 ℃ and pH=6.0, as determined by orthogonal test. Under the optimal reaction conditions, purified OPMA bad a specific activity of 13.75 U/rag. These findings suggest that OPMA could be used for the production of some oligosaccharides beneficial to the food industry and medicine.
文摘AIM To estimate the efficacy of 2 h post-endoscopic retrograde cholangiopancreatography(ERCP) serum amylase levels and other factors for predicting postERCP pancreatitis.METHODS This was a retrospective,single-center cohort study of consecutive patients who underwent ERCP from January 2010 to December 2013.Serum amylase levels were measured 2 h post-procedure,and patient- and procedure-related pancreatitis(PEP) risk factors wereanalyzed using a logistic model.RESULTS A total of 1520 cases(average age 72 ± 12 years,60% male) were initially enrolled in this study,and 1403 cases(725 patients) were ultimately analyzed after the exclusion of 117 cases.Fifty-five of these cases developed PEP.We established a 2 h serum amylase cutoff level of two times the upper limit of normal for predicting PEP.Multivariate analysis revealed that a cannulation time of more than 13 min [odds ratio(OR) 2.28,95%CI:1.132-4.651,P=0.0210] and 2 h amylase levels greater than the cutoff level(OR=24.1,95%CI:11.56-57.13,P<0.0001) were significant predictive factors for PEP.Forty-seven of the 55 patients who developed PEP exhibited 2 h amylase levels greater than the cutoff level(85%),and six of the remaining eight patients who developed PEP(75%) required longer cannulation times.Only 2 of the 1403 patients(0.14%) who developed PEP did not exhibit concerning 2 h amylase levels or require longer cannulation times.CONCLUSION These findings indicate that the combination of 2 h post-ERCP serum amylase levels and cannulation times represents a valuable marker for identifying patients at high risk for PEP.
文摘AIM: To clarify the relationship between the change of serum amylase level and post-ERCP pancreatitis. METHODS: Between January 1999 and December 2002, 1291 ERCP-related procedures were performed. Serum amylase concentrations were measured before the procedure and 3, 6, and 24 h afterward. The frequency and severity of post-ERCP pancreatitis and the relationship between these phenomena and the change in amylase level were estimated. RESULTS: Post-ERCP pancreatitis occurred in 47 patients (3.6%). Pancreatitis occurred in 1% of patients with normal amylase levels 3 h after ERCP, and in 1%, 5%, 20%, 31% and 39% of patients with amylase levels elevated 1-2 times, 2-3 times, 3-5 times, 5-10 times and over 10 times the upper normal limit at 3 h after ERCP, respectively (level < 2 times vs ≥ 2 times, P < 0.001). Of the 143 patients with levels higher than the normal limit at 3 h after ERCP followed by elevation at 6 h, pancreatitis occurred in 26%. In contrast, pancreatitis occurred in 9% of 45 patients with a level higher than two times the normal limit at 3 h after ERCP followed by a decrease at 6 h (26% vs 9%, P < 0.05). CONCLUSION: Post-ERCP pancreatitis is frequently associated with an increase in serum amylase level greater than twice the normal limit at 3 h after ERCP with an elevation at 6 h. A decrease in amylase level at 6 h after ERCP suggests the unlikelihood of development of post-ERCP pancreatitis.
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
