This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
Construction of a food-grade expression vector for application to lactic acid bacteria（LAB） is of importance for dairy fermentation system. An α-galactosidase（aga） gene encoding an enzyme degrading melibiose was ...Construction of a food-grade expression vector for application to lactic acid bacteria（LAB） is of importance for dairy fermentation system. An α-galactosidase（aga） gene encoding an enzyme degrading melibiose was amplified by PCR from the plasmid p RAF800 of Lactococcus lactis NZ9000. The aga gene was introduced into pMG36 e to substitute the p rimary antibiotic selectable marker of pMG36 e, resulting in construction of a new food-grade expression vector pMG36-aga. To testify the expression efficiency of exogenous gene in pMG36-aga, a 1.5 kb long α-amylase（amy） gene from Ba cillus li cheniformis was cloned by PCR and introduced into the plasmid pMG36-aga. The resultant plasimd pMG36-aga-amy was transformed into L. lactis ML23 by electroporation. The positive clones were selected with the medium containing melibiose as the sole carbon source. Th e selection efficiency of aga was 8.71×103 CFU with a standard deviation of 9.1×102 CFU ？g-1 DNA of pMG36-aga. Furthermore, the SDS-PAGE analysis showed that the pMG36-aga-amy expressed a 56.4 kDa protein which was the same as the putati ve molecular weight of α-amylase. The starch plate assay also indicated that L. lactis ML23 displayed high activity of α-amylase by expressing of amy gene of pMG36-aga-amy.展开更多
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
基金supported by the National High-Tech R&D Program of China (863 Program, 2006AA10Z317)
文摘Construction of a food-grade expression vector for application to lactic acid bacteria（LAB） is of importance for dairy fermentation system. An α-galactosidase（aga） gene encoding an enzyme degrading melibiose was amplified by PCR from the plasmid p RAF800 of Lactococcus lactis NZ9000. The aga gene was introduced into pMG36 e to substitute the p rimary antibiotic selectable marker of pMG36 e, resulting in construction of a new food-grade expression vector pMG36-aga. To testify the expression efficiency of exogenous gene in pMG36-aga, a 1.5 kb long α-amylase（amy） gene from Ba cillus li cheniformis was cloned by PCR and introduced into the plasmid pMG36-aga. The resultant plasimd pMG36-aga-amy was transformed into L. lactis ML23 by electroporation. The positive clones were selected with the medium containing melibiose as the sole carbon source. Th e selection efficiency of aga was 8.71×103 CFU with a standard deviation of 9.1×102 CFU ？g-1 DNA of pMG36-aga. Furthermore, the SDS-PAGE analysis showed that the pMG36-aga-amy expressed a 56.4 kDa protein which was the same as the putati ve molecular weight of α-amylase. The starch plate assay also indicated that L. lactis ML23 displayed high activity of α-amylase by expressing of amy gene of pMG36-aga-amy.
