Detection of Novel BEST1 Variations in Autosomal Recessive Bestrophinopathy Using Third-generation Sequencing

Objective:Autosomal recessive bestrophinopathy(ARB),a retinal degenerative disease,is characterized by central visual loss,yellowish multifocal diffuse subretinal deposits,and a dramatic decrease in the light peak on electrooculogram.The potential pathogenic mechanism involves mutations in the BEST1 gene,which encodes Ca2+-activated Cl−channels in the retinal pigment epithelium(RPE),resulting in degeneration of RPE and photoreceptor.In this study,the complete clinical characteristics of two Chinese ARB families were summarized.Methods:Pacific Biosciences(PacBio)single-molecule real-time(SMRT)sequencing was performed on the probands to screen for disease-causing gene mutations,and Sanger sequencing was applied to validate variants in the patients and their family members.Results:Two novel mutations,c.202T>C(chr11:61722628,p.Y68H)and c.867+97G>A,in the BEST1 gene were identified in the two Chinese ARB families.The novel missense mutation BEST1 c.202T>C(p.Y68H)resulted in the substitution of tyrosine with histidine in the N-terminal region of transmembrane domain 2 of bestrophin-1.Another novel variant,BEST1 c.867+97G>A(chr11:61725867),located in intron 7,might be considered a regulatory variant that changes allele-specific binding affinity based on motifs of important transcriptional regulators.Conclusion:Our findings represent the first use of third-generation sequencing(TGS)to identify novel BEST1 mutations in patients with ARB,indicating that TGS can be a more accurate and efficient tool for identifying mutations in specific genes.The novel variants identified further broaden the mutation spectrum of BEST1 in the Chinese population.

To Analyze the Sensitivity of RT-PCR Assays Employing S Gene Target Failure with Whole Genome Sequencing Data during Third Wave by SARS-CoV-2 Omicron Variant

Introduction: Omicron is a highly divergent variant of concern (VOCs) of a severe acute respiratory syndrome SARS-CoV-2. It carries a high number of mutations in its spike protein hence;it is more transmissible in the community by immune evasion mechanisms. Due to mutation within S gene, most Omicron variants have reported S gene target failure (SGTF) with some commercially available PCR kits. Such diagnostic features can be used as markers to screen Omicron. However, Whole Genome Sequencing (WGS) is the only gold standard approach to confirm novel microorganisms at genetically level as similar mutations can also be found in other variants that are circulating at low frequencies worldwide. This Retrospective study is aimed to assess RT-PCR sensitivity in the detection of S gene target failure in comparison with whole genome sequencing to detect variants of Omicron. Methods: We have analysed retrospective data of SARS-CoV-2 positive RT-PCR samples for S gene target failure (SGTF) with TaqPath COVID-19 RT-PCR Combo Kit (ThermoFisher) and combined with sequencing technologies to study the emerged pattern of SARS-CoV-2 variants during third wave at the tertiary care centre, Surat. Results: From the first day of December 2021 till the end of February 2022, a total of 321,803 diagnostic RT-PCR tests for SARS-CoV-2 were performed, of which 20,566 positive cases were reported at our tertiary care centre with an average cumulative positivity of 6.39% over a period of three months. In the month of December 21 samples characterized by the SGTF (70/129) were suggestive of being infected by the Omicron variant and identified as Omicron (B.1.1.529 lineage) when sequence. In the month of January, we analysed a subset of samples (n = 618) with SGTF (24%) and without SGTF (76%) with Ct values Conclusions: During the COVID-19 pandemic, it took almost more than 15 days to diagnose infection and identify pathogen by sequencing technology. In contrast to that molecular assay provided quick identification with the help of SGTF phenomenon within 5 hours of duration. This strategy helps scientists and health policymakers for the quick isolation and identification of clusters. That ultimately results in a decreased transmission of pathogen among the community.

The Influence of Aerial Exposure on Sea Anemones Aulactinia veratra Mucin Genes Expression Using the RNA Sequencing

Mucin genes are the main component of mucus. The sea anemone species, Aulactinia veratra (Phylum Cnidaria) contains different types of mucin genes. In the intertidal zone, A. veratra is found to be exposed to air during the low tide and produces large quantities of mucus as an external covering. The relation between low tide and mucus secretion is still unclear, and what is the role of mucin during arial exposure is not yet investigated. This study hypothesised that the mucin genes in A. veratra would have significantly high expression in response to aerial exposure. Therefore, the aim of current study was to examine and analyses the response of A. veratra mucins in response to an experiment involving three hours of aerial exposure. To achieve this, aim the RNA-sequencing and bioinformatics analyses were used to examine the expression profile of A. veratra mucin genes in response to aerial exposure. The generated results have shown that, Mucin4-like and mucin5B-like were up-regulated in response to the three hours of aerial exposure in A. veratra. This finding shows a significant role of mucin5B-like and mucin4-like genes in response to air stress at low tide. The data generated from this study could be used in conjunction with future mucin gene studies of sea anemones and other cnidarians to compare A. veratra mucin gene expression results across time, and to extend our understanding of mucin stress response in this phylum.

PCR-SSCP-DNA sequencing method in detecting PTEN gene mutation and its signifi cance in human gastric cancer

AIM: To discuss the possible effect of PTEN gene mutations on occurrence and development of gastric cancer. METHODS: Fifty-three gastric cancer specimens were selected to probe PTEN gene mutations in genome of gastric cancer and paracancerous tissues using PCR-SSCP-DNA sequencing method based on microdissection and to observe the protein expression by immunohistochemistry technique. RESULTS: PCR-SSCP-DNA sequencing indicated that 4 kinds of mutation sites were found in 5 of 53 gastric cancer specimens. One kind of mutation was found in exons. AA-TCC mutation was located at 40bp upstream of 3’ lateral exon 7 (115946 AA-TCC). Such mutations led to terminator formation in the 297th codon of the PTEN gene. The other 3 kinds of mutation were found in introns,including a G-C point mutation at 91 bp upstream of 5’ lateral exon 5(90896 G-C),a T-G point mutation at 24 bp upstream of 5’ lateral exon 5 (90963 T-G),and a single base A mutation at 7 bp upstream of 5’ lateral exon 5 (90980 A del). The PTEN protein expression in gastric cancer and paracancerous tissues detected using immunohistochemistry technique indicated that the total positive rate of PTEN protein expression was 66% in gastric cancer tissue,which was significantly lower than that (100%) in paracancerous tissues (P < 0.005). CONCLUSION: PTEN gene mutation and expression may play an important role in the occurrence and development of gastric cancer.

The diverse heterogeneity of molecular alterations in prostate cancer identified through next-generation sequencing

Prostate cancer is a leading cause of global cancer-related death but attempts to improve diagnoses and develop novel therapies have been confounded by significant patient heterogeneity. In recent years, the application of next-generation sequencing to hundreds of prostate tumours has defined novel molecular subtypes and characterized extensive genomic aberration underlying disease initiation and progression. It is now clear that the heterogeneity observed in the clinic is underpinned by a molecular landscape rife with complexity, where genomic rearrangements and rare mutations combine to amplify transcriptomic diversity. This review dissects our current understanding of prostate cancer ＇omics＇, including the sentinel role of copy number variation, the growing spectrum of oncogenic fusion genes, the potential influence of chromothripsis, and breakthroughs in defining mutation-associated subtypes. Increasing evidence suggests that genomic lesions frequently converge on specific cellular functions and signalling pathways, yet recurrent gene aberration appears rare. Therefore, it is critical that we continue to define individual tumour genomes, especially in the context of their expressed transcriptome. Only through improved characterisation of tumour to tumour variability can we advance to an age of precision therapy and personalized oncology.

Genome-wide identification and comparative analysis of drought related genes in roots of two maize inbred lines with contrasting drought tolerance by RNA sequencing

Drought is one of the most important abiotic stresses affecting maize growth and development and therefore resulting in yield loss.Thus it is essential to understand molecular mechanisms of drought stress responses in maize for drought tolerance improvement.The root plays a critical role in plants sensing water deficit.In the present study,two maize inbred lines,H082183,a drought-tolerant line,and Lv28,a drought-sensitive line,were grown in the field and treated with different water conditions(moderate drought,severe drought,and well-watered conditions)during vegetative stage.The transcriptomes of their roots were investigated by RNA sequencing.There were 1428 and 512 drought-responsive genes(DRGs)in Lv28,688 and 3363 DRGs in H082183 under moderate drought and severe drought,respectively.A total of 31 Gene Ontology(GO)terms were significantly over-represented in the two lines,13 of which were enriched only in the DRGs of H082183.Based on results of Kyoto encyclopedia of genes and genomes(KEGG)enrichment analysis,"plant hormone signal transduction"and"starch and sucrose metabolism"were enriched in both of the two lines,while"phenylpropanoid biosynthesis"was only enriched in H082183.Further analysis revealed the different expression patterns of genes related to abscisic acid(ABA)signal pathway,trehalose biosynthesis,reactive oxygen scavenging,and transcription factors might contribute to drought tolerance in maize.Our results contribute to illustrating drought-responsive molecular mechanisms and providing gene resources for maize drought improvement.

Proteolipid protein 1 gene sequencing of hereditary spastic paraplegia

PCR amplification and sequencing of whole blood DNA from an individual with hereditary spastic paraplegia, as well as family members, revealed a fragment of proteolipid protein 1 （PLP1） gene exon 1, which excluded the possibility of isomer 1 expression for this family. The fragment sequence of exon 3 and exon 5 was consistent with the proteolipid protein 1 sequence at NCBI. In the proband samples, a PLP1 point mutation in exon 4 was detected at the basic group of position 844, T→C, phenylalanine→leucine. In proband samples from a male cousin, the basic group at position 844 was C, but gene sequencing signals revealed mixed signals of T and C, indicating possible mutation at this locus. Results demonstrated that changes in PLP1 exon 4 amino acids were associated with onset of hereditary spastic paraplegia.

Identification of a LMNA (c.646C>T) variant by whole-exome sequencing in combination with a dilated cardiomyopathy (DCM) related gene filter in a family with familiar DCM

Dilated cardiomyopathy（DCM）is characterized by the dilated heart chambers and reduced systolic function in the absence of specific aetiology[1].Approximately one third of DCM cases are hereditary.In recent years,DCM concomitant with arrhythmias and sudden death resulting from gene mutation has been widely

A novel Nance-Horan syndrome mutation identified by next-generation sequencing in a Chinese family

AIM: To identify the disease-causing mutation in a fourgeneration Chinese family diagnosed with Nance-Horan syndrome(NHS). METHODS: A Chinese family, including four affected patients and four healthy siblings, was recruited. All family members received ophthalmic examinations with medical histories provided. Targeted next-generation sequencing approach was conducted on the two affected males to screen for their disease-causing mutations. RESULTS: Two male family members diagnosed with NHS manifested bilateral congenital cataracts microcornea, strabismus and subtle facial and dental abnormalities, while female carriers presented posterior Y-sutural cataracts. A novel frameshift mutation(c.3916_3919 del) in the NHS gene was identified. This deletion was predicted to alter the reading frame and generate a premature termination codon after a new reading frame. CONCLUSION: The study discovers a new frameshift mutation in a Chinese family with NHS. The findings broaden the spectrum of NHS mutations that can cause NHS in Chinese patients.

Fecal gene detection based on next generation sequencing for colorectal cancer diagnosis

BACKGROUND Colorectal cancer(CRC)is one of the most common malignancies worldwide.Given its insidious onset,the condition often already progresses to advanced stage when symptoms occur.Thus,early diagnosis is of great significance for timely clinical intervention,efficacy enhancement,and prognostic improvement.Featuring high throughput,fastness,and rich information,next generation sequencing(NGS)can greatly shorten the detection time,which is a widely used detection technique at present.AIM To screen specific genes or gene combinations in fecal DNA that are suitable for diagnosis and prognostic prediction of CRC,and to establish a technological platform for CRC screening,diagnosis,and efficacy monitoring through fecal DNA detection.METHODS NGS was used to sequence the stool DNA of patients with CRC,which were then compared with the genetic testing results of the stool samples of normal controls and patients with benign intestinal disease,as well as the tumor tissues of CRC patients.Specific genes or gene combinations in fecal DNA suitable for diagnosis and prognostic prediction of CRC were screened,and their significances in diagnosing CRC and predicting patients'prognosis were comprehensively evaluated.RESULTS High mutation frequencies of TP53,APC,and KRAS were detected in the stools and tumor tissues of CRC patients prior to surgery.Contrastively,no pathogenic mutations of the above three genes were noted in the postoperative stools,the normal controls,or the benign intestinal disease group.This indicates that tumor-specific DNA was detectable in the preoperative stools of CRC patients.The preoperative fecal expression of tumor-associated genes can reflect the gene mutations in tumor tissues to some extent.Compared to the postoperative stools and the stools in the two control groups,the pathogenic mutation frequencies of TP53 and KRAS were significantly higher for the preoperative stools(χ^(2)=7.328,P<0.05;χ^(2)=4.219,P<0.05),suggesting that fecal TP53 and KRAS genes can be used for CRC screening,diagnosis,and prognostic prediction.No significant difference in the pathogenic mutation frequency of the APC gene was found from the postoperative stools or the two control groups(χ^(2)=0.878,P>0.05),so further analysis with larger sample size is required.Among CRC patients,the pathogenic mutation sites of TP53 occurred in 16 of 27 preoperative stools,with a true positive rate of 59.26%,while the pathogenic mutation sites of KRAS occurred in 10 stools,with a true positive rate of 37.04%.The sensitivity and negative predictive values of the combined genetic testing of TP53 and KRAS were 66.67%(18/27)and 68.97%,respectively,both of which were higher than those of TP53 or KRAS mutation detection alone,suggesting that the combined genetic testing can improve the CRC detection rate.The mutation sites TP53 exon 4 A84G and EGFR exon 20 I821T(mutation start and stop positions were both 7579436 for the former,while 55249164 for the latter)were found in the preoperative stools and tumor tissues.These"undetected"mutation sites may be new types of mutations occurring during the CRC carcinogenesis and progression,which needs to be confirmed through further research.Some mutations of"unknown clinical significance"were found in such genes as TP53,PTEN,KRAS,BRAF,AKT1,and PIK3CA,whose clinical values is worthy of further exploration.CONCLUSION NGS-based fecal genetic testing can be used as a complementary technique for the CRC diagnosis.Fecal TP53 and KRAS can be used as specific genes for the screening,diagnosis,prognostic prediction,and recurrence monitoring of CRC.Moreover,the combined testing of TP53 and KRAS genes can improve the CRC detection rate.

Cloning, sequencing and analyzing of the heavy chain V region genes of human polyreactive antibodies

The heavy chain variable region genes of 5 human polyreactive mAbs generated in our laboratory have been cloned and sequenced using polymerase chain reaction (PCR) technique. We found that 2 and 3 mAbs utilized genes of the VHIV and VHIII families, respectively. The former 2 VH segments were in germline configuration. A common VH segment, with the best similarity of 90.1 % to the published VHIII germline genes, was utilized by 2 different rearranged genes encoding the V regions of other 3 mAbs. This strongly suggests that the common VH segment is a unmutated copy of an unidentified germline VHIII gene. All these polyreactive mAbs displayed a large NDN region (VH-D-JH junction). The entire H chain V regions of these polyreactive mAbs are unusually basic. The analysis of the charge properties of these mAbs as well as those of other poly- and mono- reactive mAbs from literatures prompts us to propose that the charged amino acids with a particular distribution along the H chain V region,especially the binding sites (CDRs), may be an important structural feature involved in antibody polyreactivity.

Detection of a novel panel of 24 genes with high frequencies of mutation in gastric cancer based on next-generation sequencing

BACKGROUND Gastric cancer is a leading cause of cancer-related mortality worldwide.Many somatic mutations have been identified based on next-generation sequencing;they likely play a vital role in cancer treatment selection.However,nextgeneration sequencing has not been widely used to diagnose and treat gastric cancer in the clinic.AIM To test the mutant gene frequency as a guide for molecular diagnosis and personalized therapy in gastric cancer by use of next-generation sequencing.METHODS We constructed a panel of 24 mutant genes to detect somatic nucleotide variations and copy number variations based on a next-generation sequencing technique.Our custom panel included high-mutation frequency cancer driver and tumour suppressor genes.Mutated genes were also analyzed using the cBioPortal database.The clinical annotation of important variant mutation sites was evaluated in the ClinVar database.We searched for candidate drugs for targeted therapy and immunotherapy from the OncoKB database.RESULTS In our study,the top 16 frequently mutated genes were TP53(58%),ERBB2(28%),BRCA2(23%),NF1(19%),PIK3CA(14%),ATR(14%),MSH2(12%),FBXW7(12%),BMPR1A(12%),ERBB3(11%),ATM(9%),FGFR2(8%),MET(8%),PTEN(6%),CHD4(6%),and KRAS(5%).TP53 is a commonly mutated gene in gastric cancer and has a similar frequency to that in the cBioPortal database.33 gastric cancer patients(51.6%)with microsatellite stability and eight patients(12.5%)with microsatellite instability-high were investigated.Enrichment analyses demonstrated that high-frequency mutated genes had transmembrane receptor protein kinase activity.We discovered that BRCA2,PIK3CA,and FGFR2 gene mutations represent promising biomarkers in gastric cancer.CONCLUSION We developed a powerful panel of 24 genes with high frequencies of mutation that could detect common somatic mutations.The observed mutations provide potential targets for the clinical treatment of gastric cancer.

Polymorphic Analysis of TLR2 Gene in Native Hainan Pig Breeds Based on Sequencing Technology

[Objective]The paper was to understand the polymorphism of TLR2 gene in native Hainan pig breeds.[Method]TLR2 gene were cloned from blood samples of Wuzhishan pigs,Lingao pigs and Tunchang pigs by PCR and sequenced.[Result]The DNA sequence of TLR2 gene in native Hainan pig breeds was 2649 bp and its CDS was 2358 bp.The intra-specific alignment of TLR2 gene sequences of the three pigs showed that there were seven nucleotide polymorphisms in Wuzhishan pigs(two of which located in the coding region),five nucleotide polymorphisms in Tunchang pigs(all of which were outside the coding region)and four nucleotide polymorphisms in Lingao pigs(one of which was located in the coding region).The results of inter-specific comparison showed that there were 12 nucleotide polymorphisms in three pig breeds,three of polymorphisms were missense mutations,resulting in changes in amino acids.The results of homologous analysis showed that the TLR2 gene sequences of the three pig breeds were highly conservative,with the homology ranging from 99.6% to 99.9%.Prediction and analysis of protein structure showed that AG mutation at 876 and 1454 sites of TLR2 gene in native Hainan pigs caused changes in secondary and tertiary structure of the protein,suggesting there might be possible changes in the function of TLR2.[Conclusion]The study provided reference for further research on the relationship between polymorphism of TLR2 gene and epidemic susceptibility of pigs.

A Multiplex PCR-Based Next-Generation Sequencing Approach Has Detected a Common Large Deletion in STS Gene in a Patient with X-Linked Ichthyosis

Several nuclear genes have been found to be linked to ichthyosis, and Next Generation Sequencing approach on panels of targeted genes has turned out to be particularly useful in analyzing diseases characterized by significant genetic and phenotypic heterogeneity. We developed a panel of 26 genes to be screened with the Ion Personal Genome Machine (PGM) for causative mutations relating to ichthyosis. Sequencing runs were obtained from a patient with ichthyosis using the Ion Torrent PGM and then processed with Ion Torrent Suite, Variant Caller, Coverage Analysis and wANNOVER tools. No causative mutations were found using Variant Caller and wANNOVER softwares, whereas the “Coverage Analysis” tool revealed a common large deletion in STS gene in a patient with X-linked ichthyosis. Identification of indels in Next Generation Sequencing (NGS) data is a veritable challenge. This study demonstrates the efficacy and effectiveness of using NGS approach to detect large deletions without resorting to specific algorithms for “indel” detection. Our results indicate that the NGS panel is a useful, rapid and cost-effective screening test for patients whose features are suggestive of a genetic etiology involving one of the genes embedded in the panel. It is an excellent alternative to Sanger sequencing as for costs, ease of analysis, and turnaround time.

Gene sequencing technology and its applications in cancer precision medicine

In clinical oncology,gene mutation detection plays a pivotal role in precision medicine.With advances in gene sequencing technology,the cost and time of sequencing decrease and its throughput increases.Gene sequencing technology can be utilized to detect and analyze the cancer-associated genes and underlying molecular mechanism.These data will assist clinicians to prescribe rational treatment programs for patients with cancer better,ultimately improving their prognosis.This review will provide insights into gene sequencing technology and its applications in cancer precision medicine.

Mechanism of Guangdong Shenqu in regulating intestinal flora in mice with food stagnation and internal heat based on 16S rDNA sequencing

Objective:To investigate the effect of Guangdong Shenqu(GSQ)on intestinal flora structure in mice with food stagnation through 16S rDNA sequencing.Methods: Mice were randomly assigned to control,model,GSQ low-dose(GSQL),GSQ medium-dose(GSQM),GSQ high-dose(GSQH),and lacidophilin tablets(LAB)groups,with each group containing 10 mice.A food stagnation and internal heat mouse model was established through intragastric administration of a mixture of beeswax and olive oil(1:15).The control group was administered normal saline,and the model group was administered beeswax and olive oil to maintain a state.The GSQL(2 g/kg),GSQM(4 g/kg),GSQH(8 g/kg),and LAB groups(0.625 g/kg)were administered corresponding drugs for 5 d.After administration,16S rDNA sequencing was performed to assess gut microbiota in mouse fecal samples.Results: The model group exhibited significant intestinal flora changes.Following GSQ administration,the abundance and diversity index of the intestinal flora increased significantly,the number of bacterial species was regulated,andαandβdiversity were improved.GSQ administration increased the abundance of probiotics,including Clostridia,Lachnospirales,and Lactobacillus,whereas the abundance of conditional pathogenic bacteria,such as Allobaculum,Erysipelotrichaceae,and Bacteroides decreased.Functional prediction analysis indicated that the pathogenesis of food stagnation and GSQ intervention were primarily associated with carbohydrate,lipid,and amino acid metabolism,among other metabolic pathways.Conclusion: The digestive mechanism of GSQ may be attributed to its role in restoring diversity and abundance within the intestinal flora,thereby improving the composition and structure of the intestinal flora in mice and subsequently influencing the regulation of metabolic pathways.

Amplification and sequencing of a sulfur-rich 10kd prolamin gene from rice seeds

Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far, several sufur-rich seed protein genes have been isolated and the essential amino acid contents of seed proteins were increased in transgenic tobacco and Brassica napus. In this paper we report the isolation and sequencing of the 10kd prolamin gene from seeds. Poly(A) RNA were prepared from the immature endosperms of japonica rice, Sachiminori, 10 d after flowering. Complementary DNAs were synthesized according to Promega Instruction Manual. Two primers were synthesized and their sequences were Primer Ⅰ: CGTCTACACCATCTGGAATC, Primer Ⅱ: GTGTTTGCAGATAGTATGC. The amplified fragraents were inserted into the Sma I site of pGEM-7zf(+) and was used to transform E. coli JM101 after PCR reaction. DNA sequence were determined by Sanger’s Chain-termination method. Synthesis of cDNA. Using mRNAs as