In order to investigate microbial community structures in different wastewater treatment processes and understand the relationship between the structures and the status of processes,the microbial community diversity,v...In order to investigate microbial community structures in different wastewater treatment processes and understand the relationship between the structures and the status of processes,the microbial community diversity,variety and distribution in five wastewater treatment pro cesses were studied by a culture-independent genetic fingerprinting technique single-strand conformation poly-morphism(SSCP).The five processes included denitrifying and phosphate-removal system(diminished N),Chinese traditional medicine wastewater treatment system(P),beer wastewater treatment system(W),fermentative biohydrogen-producing system(H),and sulfate-reduction system(S).The results indicated that the microbial community profiles in the wastewater bioreactors with the uniform status were very similar.The diversity of microbial populations was correlated with the complexity of organic contaminants in wastewater.Chinese traditional medicine wastewater contained more complex organic components;hence,the population diversity was higher than that of simple nutrient bioreactors fed with molasses wastewater.Compared with the strain bands in a simulated community,the relative proportion of some functional microbial populations in bioreactors was not dom-inant.Fermentative biohydrogen producer Ethanoligenens harbinense in the better condition bioreactor had only a 5% band density,and the Desulfovibrio sp.in the sulfate-reducing bioreactor had less than 1.5%band density.The SSCP profiles could identify the difference in microbial community structures in wastewater treatment processes,monitor some of the functional microbes in these processes,and consequently provide useful guidance for improving their efficiency.展开更多
OBJECTIVE: To screen the 5' regulatory region of the aldose reductase (AR) gene for genetic variabilities causing changes in protein expression and affecting the promoter function. METHODS: The screenings were car...OBJECTIVE: To screen the 5' regulatory region of the aldose reductase (AR) gene for genetic variabilities causing changes in protein expression and affecting the promoter function. METHODS: The screenings were carried out by polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP). All SSCP variants were submitted for DNA sequencing and inserted into the plasmid chloromycetin acetyl transferase (CAT) enhancer vector. The constructs were used to transfect Hela cells, and CAT assays were performed to assess promoter activity. Gel mobility shift and footprinting assays were also performed to determine the interaction between the DNA and nuclear proteins. RESULTS: Two polymorphisms, C (-106) T and C (-12) G, were identified in the regulatory region in 123 Chinese control subjects and 145 patients with type 2 diabetes mellitus. The frequencies of genotypes WT/WT, WT/C (-12) G and WT/C (-106) T were not significantly different between the subjects and patients. In the patients with and without retinopathy, frequencies of WT/C (-106) T were 31.5% and 17.5% (P 0.05) respectively. The total frequency of WT/C (-12) G and WT/C (-106) T in patients with retinopathy was 41.8%, significantly higher than that (20.0%) in patients without retinopathy (P展开更多
This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
Objective To detect mutations of the retinitis pigmentosa GTPase regulator (RPGR) gene in two Chinese X-linked retinitis pigmentosa families. Methods Fragments of exons 1-19 of the RPGR gene were amplified with intron...Objective To detect mutations of the retinitis pigmentosa GTPase regulator (RPGR) gene in two Chinese X-linked retinitis pigmentosa families. Methods Fragments of exons 1-19 of the RPGR gene were amplified with intronic primers, using genomic DNA as template. The polymerase chain reaction (PCR) products were analysed by single-strand conformation polymorphism (SSCP) and direct sequencing. Mutations were identified by comparing DNA sequences of the patients with those of the normal controls.Results Two novel mutations, c1536delC and E332X, were identified in exons 12 and 9 of the RPGR gene in both families. Each mutation was the first mutation found in their respective exons. Both mutations were predicted to cause premature termination, which resulted in truncated proteins without normal functions of the RPGR products.Conclusions Both mutations are the genetic basis of the pathogenesis in the respective families. Our data might be helpful in analysing the function of the RPGR protein.展开更多
The traditional culture-dependent plate counting and culture-independent small-subunit-ribosomal RNA gene-targeted molecular techniques, Single-Strand Conformation Polymorphism (SSCP) and ter-minal Restriction Fragmen...The traditional culture-dependent plate counting and culture-independent small-subunit-ribosomal RNA gene-targeted molecular techniques, Single-Strand Conformation Polymorphism (SSCP) and ter-minal Restriction Fragment Length Polymorphism (tRFLP) combined with 16S rDNA clone library were adopted to investigate the impacts of secretion from Camptotheca acuminata (abbreviated to Ca) roots on the quantities and structure of eukaryotic microbes and bacteria in the rhizosphere, and the possi-bility that Ca controls exotic invasive plant Eupatorium adenophorum (Ea). The counting results indi-cated that the number of bacteria increased in turn in rhizospheres of Ea, Ca-Ea mixed culture and Ca, while that of eukaryotic microbes decreased. PCR-SSCP profiles showed eukaryotic microbial bands (corresponding to biodiversity) in rhizosphere of Ea were more complex than those of Ca and CE. Meristolohmannia sp., Termitomyces sp. and Rhodophyllus sp. were the dominant populations in the rhizosphere of Ca. Bacterial terminal restriction fragments (TRFs) profiles showed no difference among three kinds of rhizospheres, and the sequences of the 16S rDNA clone library from Ca rhizospheres were distributed in 10 known phyla, in which phylum Proteobacteria were the absolute dominant group and accounted for 24.71% of the cloned sequences (δ-Proteobacteria accounted for up to 17.65%), and phyla Acidobacteria and Bacteroidetes accounted for 16.47% and 10.59% of the cloned sequences, respectively. In addition, high performance liquid chromatography detected a trace amount of camp-tothecin and hydroxycamptothecin in the rhizospheric soil of Ca and CE, but examined neither camp-tothecin nor hydroxycamptothecin in rhizospheric soil of Ea. Therefore, invasion and diffusion of Ea evidently depended on distinguishing the eukaryotic community structure, but not on that of the bac-terial pattern. Ca was able to alter the eukaryotic community structure of invasive Ea by secreting camptothecin and hydroxycamptothecin into rhizospheres, and may benefit the control of overspread of Ea. This study provided theoretical evidence for rhizospheric microbial aspects on substituting Ca for Ea.展开更多
Several methods of mutation detection, such as single-strand conformation polymorphism (SSCP), tandem SSCP/heteroduplex analysis and SNaPshot analysis were developed using homemade kit on AB1 310 genetic analyzer, and...Several methods of mutation detection, such as single-strand conformation polymorphism (SSCP), tandem SSCP/heteroduplex analysis and SNaPshot analysis were developed using homemade kit on AB1 310 genetic analyzer, and were successfully applied to mutation detection of 31 colorectal tumor samples. The sieving capability of homemade kit and commercial kit were compared, results demonstrate that homemade kit has higher resolution and shorter analysis time. In clinical tumor samples, 26% K-ras (exon 1) and 24% p53 (exons 7–8) were found to have mutations, and all mutations were single point variations. A majority of mutations occurred in one gene, only 1 tumor contained alterations in the two genes, which indicates that development of colorectal cancer lies on alternate pathways, and may correlate with different gene mutations Keywords single nucleotide polymorphism (SNP) - single-strand conformation polymorphism (SSCP) - heteroduplex analysis (HA) - SNaPshot - linear polyacrylamide (LPA) - polydimethylacrylamide (PDMA)展开更多
基金This work was supported by the National Natural Science Foundation of China(Grant Nos.:50208006,30470054 and 50678049)China Postdoctoral Science Foundation(Grant No.:20070410266).
文摘In order to investigate microbial community structures in different wastewater treatment processes and understand the relationship between the structures and the status of processes,the microbial community diversity,variety and distribution in five wastewater treatment pro cesses were studied by a culture-independent genetic fingerprinting technique single-strand conformation poly-morphism(SSCP).The five processes included denitrifying and phosphate-removal system(diminished N),Chinese traditional medicine wastewater treatment system(P),beer wastewater treatment system(W),fermentative biohydrogen-producing system(H),and sulfate-reduction system(S).The results indicated that the microbial community profiles in the wastewater bioreactors with the uniform status were very similar.The diversity of microbial populations was correlated with the complexity of organic contaminants in wastewater.Chinese traditional medicine wastewater contained more complex organic components;hence,the population diversity was higher than that of simple nutrient bioreactors fed with molasses wastewater.Compared with the strain bands in a simulated community,the relative proportion of some functional microbial populations in bioreactors was not dom-inant.Fermentative biohydrogen producer Ethanoligenens harbinense in the better condition bioreactor had only a 5% band density,and the Desulfovibrio sp.in the sulfate-reducing bioreactor had less than 1.5%band density.The SSCP profiles could identify the difference in microbial community structures in wastewater treatment processes,monitor some of the functional microbes in these processes,and consequently provide useful guidance for improving their efficiency.
文摘OBJECTIVE: To screen the 5' regulatory region of the aldose reductase (AR) gene for genetic variabilities causing changes in protein expression and affecting the promoter function. METHODS: The screenings were carried out by polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP). All SSCP variants were submitted for DNA sequencing and inserted into the plasmid chloromycetin acetyl transferase (CAT) enhancer vector. The constructs were used to transfect Hela cells, and CAT assays were performed to assess promoter activity. Gel mobility shift and footprinting assays were also performed to determine the interaction between the DNA and nuclear proteins. RESULTS: Two polymorphisms, C (-106) T and C (-12) G, were identified in the regulatory region in 123 Chinese control subjects and 145 patients with type 2 diabetes mellitus. The frequencies of genotypes WT/WT, WT/C (-12) G and WT/C (-106) T were not significantly different between the subjects and patients. In the patients with and without retinopathy, frequencies of WT/C (-106) T were 31.5% and 17.5% (P 0.05) respectively. The total frequency of WT/C (-12) G and WT/C (-106) T in patients with retinopathy was 41.8%, significantly higher than that (20.0%) in patients without retinopathy (P
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
基金supported by the“863”Project(No．86310210) the National Natural Science Foundafion of China(No．3987O4O1)．
文摘Objective To detect mutations of the retinitis pigmentosa GTPase regulator (RPGR) gene in two Chinese X-linked retinitis pigmentosa families. Methods Fragments of exons 1-19 of the RPGR gene were amplified with intronic primers, using genomic DNA as template. The polymerase chain reaction (PCR) products were analysed by single-strand conformation polymorphism (SSCP) and direct sequencing. Mutations were identified by comparing DNA sequences of the patients with those of the normal controls.Results Two novel mutations, c1536delC and E332X, were identified in exons 12 and 9 of the RPGR gene in both families. Each mutation was the first mutation found in their respective exons. Both mutations were predicted to cause premature termination, which resulted in truncated proteins without normal functions of the RPGR products.Conclusions Both mutations are the genetic basis of the pathogenesis in the respective families. Our data might be helpful in analysing the function of the RPGR protein.
基金the Excellent Young Teacher’s Innovation Foundation of Northeast Forestry University to Yang FengJian,the Key Research Fund of Ministry of Educa-tion of China (Grant No.104191) the Forestry Noxious Plant Investigation Fund of State Forestry Administration of China to Zu YuanGang
文摘The traditional culture-dependent plate counting and culture-independent small-subunit-ribosomal RNA gene-targeted molecular techniques, Single-Strand Conformation Polymorphism (SSCP) and ter-minal Restriction Fragment Length Polymorphism (tRFLP) combined with 16S rDNA clone library were adopted to investigate the impacts of secretion from Camptotheca acuminata (abbreviated to Ca) roots on the quantities and structure of eukaryotic microbes and bacteria in the rhizosphere, and the possi-bility that Ca controls exotic invasive plant Eupatorium adenophorum (Ea). The counting results indi-cated that the number of bacteria increased in turn in rhizospheres of Ea, Ca-Ea mixed culture and Ca, while that of eukaryotic microbes decreased. PCR-SSCP profiles showed eukaryotic microbial bands (corresponding to biodiversity) in rhizosphere of Ea were more complex than those of Ca and CE. Meristolohmannia sp., Termitomyces sp. and Rhodophyllus sp. were the dominant populations in the rhizosphere of Ca. Bacterial terminal restriction fragments (TRFs) profiles showed no difference among three kinds of rhizospheres, and the sequences of the 16S rDNA clone library from Ca rhizospheres were distributed in 10 known phyla, in which phylum Proteobacteria were the absolute dominant group and accounted for 24.71% of the cloned sequences (δ-Proteobacteria accounted for up to 17.65%), and phyla Acidobacteria and Bacteroidetes accounted for 16.47% and 10.59% of the cloned sequences, respectively. In addition, high performance liquid chromatography detected a trace amount of camp-tothecin and hydroxycamptothecin in the rhizospheric soil of Ca and CE, but examined neither camp-tothecin nor hydroxycamptothecin in rhizospheric soil of Ea. Therefore, invasion and diffusion of Ea evidently depended on distinguishing the eukaryotic community structure, but not on that of the bac-terial pattern. Ca was able to alter the eukaryotic community structure of invasive Ea by secreting camptothecin and hydroxycamptothecin into rhizospheres, and may benefit the control of overspread of Ea. This study provided theoretical evidence for rhizospheric microbial aspects on substituting Ca for Ea.
文摘Several methods of mutation detection, such as single-strand conformation polymorphism (SSCP), tandem SSCP/heteroduplex analysis and SNaPshot analysis were developed using homemade kit on AB1 310 genetic analyzer, and were successfully applied to mutation detection of 31 colorectal tumor samples. The sieving capability of homemade kit and commercial kit were compared, results demonstrate that homemade kit has higher resolution and shorter analysis time. In clinical tumor samples, 26% K-ras (exon 1) and 24% p53 (exons 7–8) were found to have mutations, and all mutations were single point variations. A majority of mutations occurred in one gene, only 1 tumor contained alterations in the two genes, which indicates that development of colorectal cancer lies on alternate pathways, and may correlate with different gene mutations Keywords single nucleotide polymorphism (SNP) - single-strand conformation polymorphism (SSCP) - heteroduplex analysis (HA) - SNaPshot - linear polyacrylamide (LPA) - polydimethylacrylamide (PDMA)
