We encapsulated vincristine into folic acid-conjugated PEGylated liposomes to improve the anti-tumor efficacy on multidrug resistant cancers.It was observed that the drug delivery system we constructed exhibited maxim...We encapsulated vincristine into folic acid-conjugated PEGylated liposomes to improve the anti-tumor efficacy on multidrug resistant cancers.It was observed that the drug delivery system we constructed exhibited maximum cytotoxicity on KBv200 cells(multidrug resistant variant)compared with any other formulations.The semi-quantitative analysis of region of interest revealed that there was a great increase in area under curve(AUC)of a near-infrared fluorescein in solid tumors due to folic acid-mediated accumulation.Folic acid-conjugated PEGylated liposomes showed a significant tumor growth inhibiting effect in vitro and in vivo.TUNEL assay revealed that folic acid-conjugated PEGylated liposomes could induce cell apoptosis much more greatly than others.This study demonstrated that it had potential application prospective for the treatment of multidrug resistant cancer.展开更多
Objective:To explore the mechanism of all-transretinoic acid(ATRA) increasing retinoblastoma(RB) sensitivity to vincristine,and the inhibiting effect of vincristine combined with ATRA treatment on the SO-RB50 cell pro...Objective:To explore the mechanism of all-transretinoic acid(ATRA) increasing retinoblastoma(RB) sensitivity to vincristine,and the inhibiting effect of vincristine combined with ATRA treatment on the SO-RB50 cell proliferation.Methods:SO-RB50 cells were cultivated by routine culture method.Different concentrations of vincristine or ATRA were added into culture solution.After 48 h.cell counting kit-8 was used to detect the median inhibitory concentration(IC_(50)) of vincristine combined with ATRT treatment to SO-RB50 cells.SO-RB50 cells were divided into drug combination group,vincristine group,ATRA group and control group.Different drugs were added into the culture solution respectively for cell culture based on the IC_(50) value.Cell counting kit-8 was used to detect the cell proliferation every 24-h cultivation.After continuous determination for 6 d,data was processed to draw the cell growth curve.After drug use for 72 h,flow cytometry was used to detect the proportion of different cell cycles of SO-RB50 cells in each group.After drug use for 48 h,annexin V/propidium iodide method was used to detect the SO-RB50 cell apoptosis in each group.Results:The IC_(50) value of vincristine treatment on the SO-RB50 cells was 0.11 μmol/L,and ATRT was 12.84 μmol/L.The cell growth curve in control group rose gradually along with the extended culture time,but after vincristine and ATRA treatment,the cell growth curve was smooth and steady.The cell increment was the least in drug combination group and its cell growth curve was the smoothest.There was significant difference in A_(450) 48 h and 72 h after treatment(F_(grouping)=77.316,P<0.001;F_(time)=86.985,P<0.001).Compared with control group.A_(450) value in drug combination group,vincristine group,ATRA group was significantly lower(P<0.001).Compared with control group,the G_2/M phase cell proportion in vincristine group was significantly increased,while the G_0/G_1 phase cell proportion was significantly decreased:the G_0/G_1 phase cell proportion in ATRA group was significantly increased,while the S phase cell proportion was significantly decreased(F_(G0/G1)=85.878,F_s=56.455,F_(G2/M)=85.878,P<0.001).After 48 h,there was significant difference in SO-RB50 cell apoptosis rate among groups(F=11.312.P<0.05).The apoptosis rate in drug combination group was significantly higher than that of other groups(P<0.001).Condusion:ATRA can increase the sensitivity of SO-RB50 cells to vincristine.Vincristine combined with ATRA treatment can significantly increase the inhibiting effect on SO-RB50 cells,which may be related with promoting cell apoptosis and involving in cell cycle control.展开更多
Objective: To evaluate the efficacy and toxicity of M-VCA (methortrexate 30 mg/m2, vincristine 2 mg, cisplatin 70 mg/m2, adriamycin 30 mg/m2) combination chemotherapy for advanced nasopharyngeal carcinoma. Methods: Th...Objective: To evaluate the efficacy and toxicity of M-VCA (methortrexate 30 mg/m2, vincristine 2 mg, cisplatin 70 mg/m2, adriamycin 30 mg/m2) combination chemotherapy for advanced nasopharyngeal carcinoma. Methods: Thirty-five patients with advanced nasopharyngeal carcinoma, including 11 patients with untreated local advanced nasopharyngeal carcinoma and 24 patients with local-regional recurrent or metastatic nasopharyngeal carcinoma, received the chemotherapy of M-VCA. The cycle was repeated on day 22 for two cycles. All patients completed the chemotherapy courses. Results: The overall response rate was 75%, with untreated local advanced nasopharyngeal carcinomas 11/11(100%), local-regional recurrent nasopharyngeal carcinomas 12/18(67%), lung metastases 8/9(89%), bone metastases 5/9(56%), and liver metastases 1/2(50%). The main side effects included mild to moderate degree alopecia, nausea/vomiting, and neutropenia. Conclusion: M-VCA is well tolerated and has good efficacy for advanced nasopharyngeal carcinoma and is worth investigating further.展开更多
Objective To prepare the PEG-PLGA nanoparticles loaded with vincristine sulfate(VCR-loaded PEG-PLGA-NPs) and evaluate their quality.Methods VCR-loaded PEG-PLGA-NPs were prepared by the double emulsion solvent evaporat...Objective To prepare the PEG-PLGA nanoparticles loaded with vincristine sulfate(VCR-loaded PEG-PLGA-NPs) and evaluate their quality.Methods VCR-loaded PEG-PLGA-NPs were prepared by the double emulsion solvent evaporation method.The main experimental factors,which influenced the physical and chemical properties of the nanoparticles,were investigated and optimized.Results Under optimal conditions,the VCR-loaded PEG-PLGA-NPs had an average diameter of 135.9 nm with narrow size distribution.The encapsulation efficiency was 68.2%,while the drug loading capacity was 8.34%.In vitro,VCR was released from the PEG-PLGA-NPs sustainedly for more than 13 days with the total amount of 81%.Moreover,the VCR-loaded PEG-PLGA-NPs were relatively stable,which was confirmed by the stability testing.Conclusion The VCR-loaded PEG-PLGA-NPs are a promising nano drug with controlled release,which can be applied widely.展开更多
Objective: To analyze the effect of cytarabine combined with vincristine on HL-60 cell line in vitro. Methods: The median-effect equation and MTr assay were used on HL-60. Results: The cytotoxic activity of cytarab...Objective: To analyze the effect of cytarabine combined with vincristine on HL-60 cell line in vitro. Methods: The median-effect equation and MTr assay were used on HL-60. Results: The cytotoxic activity of cytarabine(Ara-C) and vincristine (VCR) used alone or in combination enhanced as drug concentration increased. The order of administration did not influence the cytotoxic activity of the combined antitumor drugs. The ratio of drug concentration was a factor to influence the killing effect. The interaction of the agents was synergistic at lower concentration, and antagonistic at higher concentration. Conclusion: The combined drugs interaction(CI 〈 1 ) was synergistic at lower concentration and antagonistic at higher concentration. The ratio of drug concentration is a significant factor that can influence the killing effect.展开更多
Objectives: The CMFEV (cyclophosphamide, methotrexate, 5-fluorouracil, epirubicin, vincristine) regimen is an innovative schedule, designed by our Group, aimed at administering five partially or totally no cross-resis...Objectives: The CMFEV (cyclophosphamide, methotrexate, 5-fluorouracil, epirubicin, vincristine) regimen is an innovative schedule, designed by our Group, aimed at administering five partially or totally no cross-resistant cytotoxic agents in breast carcinoma. It was randomly compared to CMF (cyclophosphamide, methotrexate, 5-fluorouracil) as primary treatment in operable disease and demonstrated a short-term significant increase in clinical complete response rate and a long-term significant locoregional relapse-free survival in premenopausal patients. So, it seemed worth comparing this regimen with CMF as adjuvant chemotherapy in moderate risk operable breast carcinoma. Methods: Four hundred and eighty-nine patients with stage I or II moderate risk breast carcinoma were randomized to receive CMF or CMFEV regimen for 6 cycles after surgery. Main end points were overall survival (OS), invasive disease-free survival (IDFS) and recurrence-free interval (RFI), as estimated by Kaplan-Meier analyses and log-rank tests. Results: At a median observation time of 7.3 years (range 5.4 months-10.3 years), no significant differences in OS and IDFS were observed between the two arms. Deaths from breast carcinoma were more frequent with CMF (58.5%) than with CMFEV regimen (41.7%) as well as recurrences from breast carcinoma (58.8% with CMF and 41.2% with CMFEV). These differences were not statistically significant. Conclusion: CMFEV appears more effective than CMF in preventing recurrences from primary disease in patients with moderate risk stage I-II breast carcinoma. The lack of statistical significance of the observed differences was probably due to the limited number of patients enrolled which rendered the study underpowdered.展开更多
Vincristine is a chemotherapy drug belonging to the group of Vinca alkaloids which also includes vinblastine and vindesine. It is used in hematological malignancies and solid tumors. The Vinca alkaloids are neurotoxic...Vincristine is a chemotherapy drug belonging to the group of Vinca alkaloids which also includes vinblastine and vindesine. It is used in hematological malignancies and solid tumors. The Vinca alkaloids are neurotoxic, usually causing peripheral neuropathy, and rarely cranial neuropathies. We report a case of a 33-month-old male child diagnosed with Wilms’ tumor, who had an isolated unilateral right ptosis following vincristine, with a good improvement after stopping it.展开更多
Background: The treatment used to combat acute lymphoblastic leukemia (ALL) is multidrug;therefore it is important to use active pharmacovigilance to detect, assess and analyze the likely adverse reactions which may o...Background: The treatment used to combat acute lymphoblastic leukemia (ALL) is multidrug;therefore it is important to use active pharmacovigilance to detect, assess and analyze the likely adverse reactions which may occur during the same period. Objective: To determine the frequency of adverse reactions to chemotherapeutic drugs in children with ALL. Material and Methods: Intensive pharmacovigilance was used to record the reports of adverse reactions to vincristine, L-asparaginase and the vincristine-L-asparaginase combination in children with ALL in a paediatric hospital. For each notification, the adverse reactions were analyzed in order to verify causality. Results: Forty patients were evaluated. Twenty children were female (50.0%) and 20 were male (50%). The children had a mean age, weight and height (±standard deviation: SD) of 8.1 (±3.4) years, 31.4 (±13.9) kg and 1.3 (±0.2) m, respectively. Vincristine was administered to 19 patients, vincristine plus L-asparaginase were given to 19 patients and only 2 patients used L-asparaginase. One-hundred-ninety adverse reactions were detected in the patients, with an average (±SD) of 4.8 (±2.6). Ondansetron was the drug administered for the treating of nausea and vomiting. One hundred eighty-one (95.3%) adverse reactions were identified as “definite”, 5 (2.6%) as “probable” and 4 (2.1%) as “doubtful”. Conclusions: There is a high incidence of adverse reactions by the administration of vincristine and L-asparaginase;the reactions of highest incidence were: nausea, vomiting, neutropenia, diarrhea, constipation, mucositis, headache, and abdominal pain. It is important to promote the detection, collection, reporting, assessment and treatment of ARD’s in children. It is necessary to promote the conduct further studies on pharmacovigilance with this type of treatments and to increase the duration of the studies.展开更多
Vincristine,a widely used chemotherapeutic agent for treating different cancer,often induces severe peripheral neuropathic pain.A common symptom of vincristine-induced peripheral neuropathic pain is mechanical allodyn...Vincristine,a widely used chemotherapeutic agent for treating different cancer,often induces severe peripheral neuropathic pain.A common symptom of vincristine-induced peripheral neuropathic pain is mechanical allodynia and hyperalgesia.However,mechanisms underlying vincristine-induced mechanical allodynia and hyperalgesia are not well understood.In the present study,we show with behavioral assessment in rats that vincristine induces mechanical allodynia and hyperalgesia in a PIEZO2 channel-dependent manner since gene knockdown or pharmacological inhibition of PIEZO2 channels alleviates vincristine-induced mechanical hypersensitivity.Electrophysiological results show that vincristine potentiates PIEZO2 rapidly adapting(RA)mechanically-activated(MA)currents in rat dorsal root ganglion(DRG)neurons.We have found that vincristine-induced potentiation of PIEZO2 MA currents is due to the enhancement of static plasma membrane tension(SPMT)of these cells following vincristine treatment.Reducing SPMT of DRG neurons by cytochalasin D(CD),a disruptor of the actin filament,abolishes vincristine-induced potentiation of PIEZO2 MA currents,and suppresses vincristine-induced mechanical hypersensitivity in rats.Collectively,enhancing SPMT and subsequently potentiating PIEZO2 MA currents in primary afferent neurons may be an underlying mechanism responsible for vincristineinduced mechanical allodynia and hyperalgesia in rats.Targeting to inhibit PIEZO2 channels may be an effective analgesic method to attenuate vincristine-induced mechanical hypersensitivity.展开更多
AIM:Vincristine is one of the most commonly used chemotherapeutic drugs to treat a variety of malignant diseases,including leukemia and lymphoma.Studies have shown that vincristine cause painful effects,whereas Salvia...AIM:Vincristine is one of the most commonly used chemotherapeutic drugs to treat a variety of malignant diseases,including leukemia and lymphoma.Studies have shown that vincristine cause painful effects,whereas Salvia officinalis(SO) showed analgesic and anti-inflammatory effects.The aim of this study is to investigate the effects of the SO hydro-alcoholic extract on vincristine-induced peripheral neuropathy in mice in comparison with morphine.METHODS:Experiments were performed on 60 NMRI male mice weighing 25-30 g divided into six groups.The individual groups received normal saline,SO hydro-alcoholic extract,vincristine,SO hydro-alcoholic extract and vincristine(12 days before formalin test),morphine,and vincristine and morphine,respectively.The injected hind paw biting and licking was measured in a 5-minute interval for one hour.RESULTS:The results showed that formalin induce significant(P < 0.05) pain responses(the first phase:0-5 min and the second phase:15-40 min after injection).Administration of SO extract before formalin test showed significant(P < 0.05) decrease of pain response in the second phase.Administration of vincristine caused significant(P < 0.05) increase in the second phase of pain response.Injections of SO extract and vincristine showed that SO significantly(P < 0.05) decrease the second phase of vincristine-induced pain.Morphine decreased vincristine-induced pain in the first and second phase of formalin test significantly(P < 0.05).In comparison,morphine showed analgesic effects in the first phase and SO extract showed significant(P < 0.05) anti-inflammatory effects in the second phase of formalin test.CONCLUSION:Both SO and vincristine showed analgesic and painful neuropathic effects,suggesting that SO extract could be useful in the treatment of vincristine-induced peripheral neuropathic pain.展开更多
An innovative molecularly imprinted electrochemical sensor was fabricated based on reduced graphene oxide (RGO) and gold nanocomposite (Au) for rapid detection of vincristine (VCR). The RGO-Au composite membrane...An innovative molecularly imprinted electrochemical sensor was fabricated based on reduced graphene oxide (RGO) and gold nanocomposite (Au) for rapid detection of vincristine (VCR). The RGO-Au composite membrane was obtained via direct one-step electrodeposition technique of graphene oxide (GO) and chloroauric acid (HAuCl4) on the surface of a glassy carbon electrode (GCE) by means of cyclic voltammetry (CV) in the potential range be- tween -1.5 and 0.6 V in phosphate buffer solution (PBS) of pH 9.18, which is capable of effectively utilizing its superior electrical conductivity, larger specific surface area due to its synergistic effect between RGO and Au. The molecularly imprinted polymers (MIPs) were synthesized on the RGO-Au modified glassy carbon electrode surface with VCR as the template molecular, methyl acrylic acid (MAA) as the functional monomer, and ethylene glycol maleic rosinate acrylate (EGMRA) as a cross-linker. The performance of the sensor was investigated by cyclic voltammetry (CV), differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS) in de- tail. Under the optimum conditions, the fabricated sensor exhibited a linear relationship between oxidation peak current and VCR concentration over the range of 5.0×10 8 5.0×10^-6 mol.L l with a correlation coefficient of 0.9952 and a detection limit (S/N=3) of 2.6×10 8 mol.L^-1. The results indicated that the imprinted polymer films exhibited an excellent selectivity for VCR. The imprinted sensor was successfully used to determine VCR in real samples with recoveries of 90%-- 120% by using the standard addition method.展开更多
Primary gastric choriocarcinoma is a rapidly growing neoplasm with an average survival of several months in untreated patients.Gastrectomy with lymph node dissection followed by chemotherapy is the treatment of choice...Primary gastric choriocarcinoma is a rapidly growing neoplasm with an average survival of several months in untreated patients.Gastrectomy with lymph node dissection followed by chemotherapy is the treatment of choice.Regimens used for gastric adenocarcinoma are usually selected.However,median survival remains less than six months.In this case report,we describe a case of primary gastric choriocarcinoma with a clinical complete response to multidisciplinary treatment including surgery,chemotherapy,and radiofrequency ablation(RFA).The patient was originally referred for general malaise.Esophagogastroduodenoscopy demonstrated a large tumor occupying the fornix,and total gastrectomy with lymph node dissection was performed.Seven days later,multiple liver metastatic recurrences with high serum levels of beta-human chorionic gonadotropin(β-hCG) were recognized.Chemotherapy with a gonadal choriocarcinoma regimen consisting of etoposide,methotrexate,actinomycin D,cyclophosphamide,and vincristine(EMA/CO),was initiated.After three cycles,serum β-hCG decreased markedly and the tumors disappeared.Six months later,multiple lung metastatic recurrences were found.After one cycle of EMA/CO,only one nodule remained.Computed tomography-guided RFA was performed for this oligometastatic tumor.The patient has been alive with no evidence of disease for 10 years after the initial diagnosis.To the best of our knowledge,this patient with recurrent primary gastric choriocarcinoma has achieved the longest survival.The present case is the first report of choriocarcinoma metastatic to the lung successfully treated with RFA.From our retrospective analysis of recurrent or unresectable primary gastric choriocarcinoma,we propose that gonadal choriocarcinoma regimens can be considered as first-line for primary gastric choriocarcinoma.展开更多
Primary gastric lymphomas(PGLs)are distinct lymphoproliferative neoplasms described as heterogeneous entities clinically and molecularly.Their main histological types are diffuse large B-cell lymphoma(DLBCL)or mucosaa...Primary gastric lymphomas(PGLs)are distinct lymphoproliferative neoplasms described as heterogeneous entities clinically and molecularly.Their main histological types are diffuse large B-cell lymphoma(DLBCL)or mucosaassociated lymphoma tissue.PGL has been one of the main fields of clinical research of our group in recent years.Although gastric DLBCLs are frequent,sufficient data to guide optimal care are scarce.Until today,a multidisciplinary approach has been applied,including chemotherapy,surgery,radiotherapy or a combination of these treatments.In this minireview article,we provide an overview of the clinical manifestations,diagnosis and staging of these diseases,along with their molecular pathogenesis and the most important related clinical published series.We then discuss the scientific gaps,perils and pitfalls that exist regarding the aforementioned studies,in parallel with the unmet need for future research and comment on the proper methodology for such retrospective studies.Aiming to fill this gap,we retrospectively evaluated the trends in clinical presentation,management and outcome among 165 patients with DLBCL PGL who were seen in our institutions in 1980-2014.The study cohort was divided into two subgroups,comparing the main 2 therapeutic options[cyclophosphamide doxorubicin vincristine prednisone(CHOP)vs rituximab-CHOP(R-CHOP)].A better outcome with immunochemotherapy(R-CHOP)was observed.In the next 2 mo,we will present the update of our study with the same basic conclusion.展开更多
Objective:To study the influence of curcumin on chemosensitivity of nephroblastoma cells.Methods:Human nephroblastoma cells line SK-NEP-1 was transplanted to the nude mice subcutaneously to establish the implantation ...Objective:To study the influence of curcumin on chemosensitivity of nephroblastoma cells.Methods:Human nephroblastoma cells line SK-NEP-1 was transplanted to the nude mice subcutaneously to establish the implantation tumor model of human nephroblastoma cells.A total of 30 tumor-bearing mice were divided into three groups of ten randomly.The routine chemotherapy group was given vincristine(0.05 mg/mL·0.2 mL/d) and actinomycin D(15 ng/mL·0.2 mL/d) combined chemotherapy regime.The curcumin chemotherapy group was given the same combined chemotherapy regimens and curcumin(30 mg/kg/d) by intraperitoneal injection.The control group was given normal saline(NS) of the same volume by intraperitoneal injection.Continuous administration would be kept for 4 weeks and 3 days a week.The volumetric changes of every group were recorded.The serum of every group in different time was collected and the VEGF content was detected by ELISA.All mice were cercrificed and the tumor tissues were stripped and weighed after 4 weeks’ treatment.The tumor inhibition rate was calculated.The cell proliferation activity and apoptosis rate were detected by MTT and flow cytometry method.All data were statistically analyzed by SPSS 19.0.Results:The tumor volume,serum VEGF content,tumor inhibition rate,cell proliferation activity and apoptosis rate of routine chemotherapy group and curcumin chemotherapy group had significant differences comparing with the control group(P<0.05) after 4-week’s treatment.The cancer growth of curcumin chemotherapy group was obviously decreased and even tended to shrink comparing with routine chemotherapy group(χ2=15.732,P=0.007).The cell proliferation activity was significantly reduced and the apoptosis rate was significantly higher,(χ~2=9.427,P=0.012)which showing the effect of chemotherapy was enhanced.Conclusions:The chemosensitivity of nephroblastoma cells could be improved by curcumin,then the effect of preoperative adjuvant chemotherapy scheme would be enhanced,the growth of nephroblastoma cells would be inhibited and the surgical risk of nephroblastoma would be reduced.展开更多
A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT (vincristine, 175 fold-resistancehigher than that in original KB cells) and ADM(...A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT (vincristine, 175 fold-resistancehigher than that in original KB cells) and ADM(adriamycin, 14. 5 fold) resulting over-expression ofMDRl. We used the primers for antisense RNA asfollowing: upstream 5′OGAATTCTGAAACCTGTAAGCAGCAACC 3′: downstream展开更多
Objective:To explore the mechanism of drug resistance in acute lymphoblastic leukemia and the anti-tumor effect of combination therapy of dehydroabietic acid and vincristine against acute lymphoblastic leukemia cells....Objective:To explore the mechanism of drug resistance in acute lymphoblastic leukemia and the anti-tumor effect of combination therapy of dehydroabietic acid and vincristine against acute lymphoblastic leukemia cells.Methods:Acute lymphoblastic leukemia cells REH and CCRFCEM were employed to detect the anti-tumor effect of vincristine and doxorubicin on proliferation and apoptosis using EdU assay,human active caspase-3 Quantikine ELISA kit,and flow cytometry.Vincristine-resistant REH cells(REH-R),survivin knockdown and overexpressing REH cells were established to verify the role of survivin in drug resistance.Additionally,in vitro and in vivo assays were performed to determine the effect of dehydroabietic acid on the cytotoxicity of vincristine.Results:Vincristine and doxorubicin markedly suppressed proliferation and induced apoptosis of REH and CCRF-CEM cells.Survivin expression was upregulated in REH-R cells compared with REH cells.Knockdown of survivin expression obviously restored the sensitivity of REH-R cells to vincristine.Akt phosphorylation was also increased in REH-R cells compared to REH cells.In addition,LY294002,a PI3k/Akt pathway blocker,inhibited survivin expression and enhanced cytotoxicity of vincristine to REH-R cells.Dehydroabietic acid effectively reduced survivin expression in REH-R cells,thereby enhancing the therapeutic effect of vincristine on drug-resistant cells.Survivin overexpression markedly reduced the effect of dehydroabietic acid on enhancing the anti-proliferation and inducing apoptosis effect of vincristine.Moreover,the combination of dehydroabietic acid with vincristine significantly extended the survival rate in a mouse xenograft model of acute lymphoblastic leukemia,compared with vincristine treatment alone.Conclusions:Dehydroabietic acid may be used as a potential candidate for the treatment of acute lymphoblastic leukemia in combination with vincristine.展开更多
Objective To evaluate the efficacy and safety of etoposide, methotrexate, actinomycin D, vincristine and cyclophosphamide (EMA/CO) therapy for gestational trophoblastic tumor (GTT). Methods Medical records of all p...Objective To evaluate the efficacy and safety of etoposide, methotrexate, actinomycin D, vincristine and cyclophosphamide (EMA/CO) therapy for gestational trophoblastic tumor (GTT). Methods Medical records of all patients with low risk, middle risk and high risk GTT receiving EMA/CO regimen chemotherapy were analyzed retrospectively. Results\ Twenty one low risk and fourteen middle risk GTT received EMA/CO with 100% remission, six patients with high risk GTT received EMA/CO with 83% complete response and with 17% partial response; Gastrointestinal, hematologic and hepatic toxicity, as well as shed of hair is predictable, mild and reversible. Conclusion\ At present EMA/CO chemotherapy is the choice of our treatment for patients with high, middle and low risk GTT.\;展开更多
A male Japanese spitz(3 years)was brought at Himalayan Animal Rescue Trust(HART),Pokhara with a complaint of swollen gums and loss of appetite.A lobulated tumorous mass was seen at the gingival region on physical exam...A male Japanese spitz(3 years)was brought at Himalayan Animal Rescue Trust(HART),Pokhara with a complaint of swollen gums and loss of appetite.A lobulated tumorous mass was seen at the gingival region on physical examination.Diagnosis and treatment of condition detected in the dog was the major objective.Impression smear of tumor cell was prepared and was observed under oil immersion microscope(100x).Microscopic examination shows the presence of vacuolations within the cytoplasm and the condition was diagnosed to be CTVT.Chemotherapy was performed using the most effective cytostatic agents I.e.Vincristine sulphate(once a week,I/v).The chemotherapy was repeated for 3 doses till the tumor gets completely regressed.The condition was resolved after third session of chemotherapy.Myelosuppression and gastrointestinal effects like vomiting are the major complications of using vincristine.展开更多
基金This work was supported by National Science and Technology Major Project(2012ZX09304004)National Basic Research Program of China(973 Program,2010CB934000)+1 种基金National Natural Science Foundation of China(81072593,81102402)Specialized Research Fund for the Doctoral Program of Higher Education(20110071130011).
文摘We encapsulated vincristine into folic acid-conjugated PEGylated liposomes to improve the anti-tumor efficacy on multidrug resistant cancers.It was observed that the drug delivery system we constructed exhibited maximum cytotoxicity on KBv200 cells(multidrug resistant variant)compared with any other formulations.The semi-quantitative analysis of region of interest revealed that there was a great increase in area under curve(AUC)of a near-infrared fluorescein in solid tumors due to folic acid-mediated accumulation.Folic acid-conjugated PEGylated liposomes showed a significant tumor growth inhibiting effect in vitro and in vivo.TUNEL assay revealed that folic acid-conjugated PEGylated liposomes could induce cell apoptosis much more greatly than others.This study demonstrated that it had potential application prospective for the treatment of multidrug resistant cancer.
基金supported by projects of Science and Technology Commission of Shanghai Municipality(No.11ZR1421300)
文摘Objective:To explore the mechanism of all-transretinoic acid(ATRA) increasing retinoblastoma(RB) sensitivity to vincristine,and the inhibiting effect of vincristine combined with ATRA treatment on the SO-RB50 cell proliferation.Methods:SO-RB50 cells were cultivated by routine culture method.Different concentrations of vincristine or ATRA were added into culture solution.After 48 h.cell counting kit-8 was used to detect the median inhibitory concentration(IC_(50)) of vincristine combined with ATRT treatment to SO-RB50 cells.SO-RB50 cells were divided into drug combination group,vincristine group,ATRA group and control group.Different drugs were added into the culture solution respectively for cell culture based on the IC_(50) value.Cell counting kit-8 was used to detect the cell proliferation every 24-h cultivation.After continuous determination for 6 d,data was processed to draw the cell growth curve.After drug use for 72 h,flow cytometry was used to detect the proportion of different cell cycles of SO-RB50 cells in each group.After drug use for 48 h,annexin V/propidium iodide method was used to detect the SO-RB50 cell apoptosis in each group.Results:The IC_(50) value of vincristine treatment on the SO-RB50 cells was 0.11 μmol/L,and ATRT was 12.84 μmol/L.The cell growth curve in control group rose gradually along with the extended culture time,but after vincristine and ATRA treatment,the cell growth curve was smooth and steady.The cell increment was the least in drug combination group and its cell growth curve was the smoothest.There was significant difference in A_(450) 48 h and 72 h after treatment(F_(grouping)=77.316,P<0.001;F_(time)=86.985,P<0.001).Compared with control group.A_(450) value in drug combination group,vincristine group,ATRA group was significantly lower(P<0.001).Compared with control group,the G_2/M phase cell proportion in vincristine group was significantly increased,while the G_0/G_1 phase cell proportion was significantly decreased:the G_0/G_1 phase cell proportion in ATRA group was significantly increased,while the S phase cell proportion was significantly decreased(F_(G0/G1)=85.878,F_s=56.455,F_(G2/M)=85.878,P<0.001).After 48 h,there was significant difference in SO-RB50 cell apoptosis rate among groups(F=11.312.P<0.05).The apoptosis rate in drug combination group was significantly higher than that of other groups(P<0.001).Condusion:ATRA can increase the sensitivity of SO-RB50 cells to vincristine.Vincristine combined with ATRA treatment can significantly increase the inhibiting effect on SO-RB50 cells,which may be related with promoting cell apoptosis and involving in cell cycle control.
文摘Objective: To evaluate the efficacy and toxicity of M-VCA (methortrexate 30 mg/m2, vincristine 2 mg, cisplatin 70 mg/m2, adriamycin 30 mg/m2) combination chemotherapy for advanced nasopharyngeal carcinoma. Methods: Thirty-five patients with advanced nasopharyngeal carcinoma, including 11 patients with untreated local advanced nasopharyngeal carcinoma and 24 patients with local-regional recurrent or metastatic nasopharyngeal carcinoma, received the chemotherapy of M-VCA. The cycle was repeated on day 22 for two cycles. All patients completed the chemotherapy courses. Results: The overall response rate was 75%, with untreated local advanced nasopharyngeal carcinomas 11/11(100%), local-regional recurrent nasopharyngeal carcinomas 12/18(67%), lung metastases 8/9(89%), bone metastases 5/9(56%), and liver metastases 1/2(50%). The main side effects included mild to moderate degree alopecia, nausea/vomiting, and neutropenia. Conclusion: M-VCA is well tolerated and has good efficacy for advanced nasopharyngeal carcinoma and is worth investigating further.
基金the National 863 Hi-tech Project for financial support (2007AA021803, 2007AA021901)
文摘Objective To prepare the PEG-PLGA nanoparticles loaded with vincristine sulfate(VCR-loaded PEG-PLGA-NPs) and evaluate their quality.Methods VCR-loaded PEG-PLGA-NPs were prepared by the double emulsion solvent evaporation method.The main experimental factors,which influenced the physical and chemical properties of the nanoparticles,were investigated and optimized.Results Under optimal conditions,the VCR-loaded PEG-PLGA-NPs had an average diameter of 135.9 nm with narrow size distribution.The encapsulation efficiency was 68.2%,while the drug loading capacity was 8.34%.In vitro,VCR was released from the PEG-PLGA-NPs sustainedly for more than 13 days with the total amount of 81%.Moreover,the VCR-loaded PEG-PLGA-NPs were relatively stable,which was confirmed by the stability testing.Conclusion The VCR-loaded PEG-PLGA-NPs are a promising nano drug with controlled release,which can be applied widely.
文摘Objective: To analyze the effect of cytarabine combined with vincristine on HL-60 cell line in vitro. Methods: The median-effect equation and MTr assay were used on HL-60. Results: The cytotoxic activity of cytarabine(Ara-C) and vincristine (VCR) used alone or in combination enhanced as drug concentration increased. The order of administration did not influence the cytotoxic activity of the combined antitumor drugs. The ratio of drug concentration was a factor to influence the killing effect. The interaction of the agents was synergistic at lower concentration, and antagonistic at higher concentration. Conclusion: The combined drugs interaction(CI 〈 1 ) was synergistic at lower concentration and antagonistic at higher concentration. The ratio of drug concentration is a significant factor that can influence the killing effect.
文摘Objectives: The CMFEV (cyclophosphamide, methotrexate, 5-fluorouracil, epirubicin, vincristine) regimen is an innovative schedule, designed by our Group, aimed at administering five partially or totally no cross-resistant cytotoxic agents in breast carcinoma. It was randomly compared to CMF (cyclophosphamide, methotrexate, 5-fluorouracil) as primary treatment in operable disease and demonstrated a short-term significant increase in clinical complete response rate and a long-term significant locoregional relapse-free survival in premenopausal patients. So, it seemed worth comparing this regimen with CMF as adjuvant chemotherapy in moderate risk operable breast carcinoma. Methods: Four hundred and eighty-nine patients with stage I or II moderate risk breast carcinoma were randomized to receive CMF or CMFEV regimen for 6 cycles after surgery. Main end points were overall survival (OS), invasive disease-free survival (IDFS) and recurrence-free interval (RFI), as estimated by Kaplan-Meier analyses and log-rank tests. Results: At a median observation time of 7.3 years (range 5.4 months-10.3 years), no significant differences in OS and IDFS were observed between the two arms. Deaths from breast carcinoma were more frequent with CMF (58.5%) than with CMFEV regimen (41.7%) as well as recurrences from breast carcinoma (58.8% with CMF and 41.2% with CMFEV). These differences were not statistically significant. Conclusion: CMFEV appears more effective than CMF in preventing recurrences from primary disease in patients with moderate risk stage I-II breast carcinoma. The lack of statistical significance of the observed differences was probably due to the limited number of patients enrolled which rendered the study underpowdered.
文摘Vincristine is a chemotherapy drug belonging to the group of Vinca alkaloids which also includes vinblastine and vindesine. It is used in hematological malignancies and solid tumors. The Vinca alkaloids are neurotoxic, usually causing peripheral neuropathy, and rarely cranial neuropathies. We report a case of a 33-month-old male child diagnosed with Wilms’ tumor, who had an isolated unilateral right ptosis following vincristine, with a good improvement after stopping it.
文摘Background: The treatment used to combat acute lymphoblastic leukemia (ALL) is multidrug;therefore it is important to use active pharmacovigilance to detect, assess and analyze the likely adverse reactions which may occur during the same period. Objective: To determine the frequency of adverse reactions to chemotherapeutic drugs in children with ALL. Material and Methods: Intensive pharmacovigilance was used to record the reports of adverse reactions to vincristine, L-asparaginase and the vincristine-L-asparaginase combination in children with ALL in a paediatric hospital. For each notification, the adverse reactions were analyzed in order to verify causality. Results: Forty patients were evaluated. Twenty children were female (50.0%) and 20 were male (50%). The children had a mean age, weight and height (±standard deviation: SD) of 8.1 (±3.4) years, 31.4 (±13.9) kg and 1.3 (±0.2) m, respectively. Vincristine was administered to 19 patients, vincristine plus L-asparaginase were given to 19 patients and only 2 patients used L-asparaginase. One-hundred-ninety adverse reactions were detected in the patients, with an average (±SD) of 4.8 (±2.6). Ondansetron was the drug administered for the treating of nausea and vomiting. One hundred eighty-one (95.3%) adverse reactions were identified as “definite”, 5 (2.6%) as “probable” and 4 (2.1%) as “doubtful”. Conclusions: There is a high incidence of adverse reactions by the administration of vincristine and L-asparaginase;the reactions of highest incidence were: nausea, vomiting, neutropenia, diarrhea, constipation, mucositis, headache, and abdominal pain. It is important to promote the detection, collection, reporting, assessment and treatment of ARD’s in children. It is necessary to promote the conduct further studies on pharmacovigilance with this type of treatments and to increase the duration of the studies.
基金supported by NSFC grant 81571080(Zhanfeng Jia,China),81872848(Wei Zhang,China)the Central Government Guiding Local Funding Project for Scientific and Technological Development 206Z7703G(Zhanfeng Jia,China)+2 种基金Key Project and Cultivation Project of Precision Medicine Joint Fund of Natural Science Foundation of Hebei Province H2021206406(Zhanfeng Jia,China),H2022206211(Wei Zhang,China)and H2020206165(Zhanfeng Jia,China)Science and Technology Project of Hebei Education Department ZD2020107(Zhanfeng Jia,China)Science Fund for Creative Research Groups of Natural Science Foundation of Hebei Province H2020206474,China.
文摘Vincristine,a widely used chemotherapeutic agent for treating different cancer,often induces severe peripheral neuropathic pain.A common symptom of vincristine-induced peripheral neuropathic pain is mechanical allodynia and hyperalgesia.However,mechanisms underlying vincristine-induced mechanical allodynia and hyperalgesia are not well understood.In the present study,we show with behavioral assessment in rats that vincristine induces mechanical allodynia and hyperalgesia in a PIEZO2 channel-dependent manner since gene knockdown or pharmacological inhibition of PIEZO2 channels alleviates vincristine-induced mechanical hypersensitivity.Electrophysiological results show that vincristine potentiates PIEZO2 rapidly adapting(RA)mechanically-activated(MA)currents in rat dorsal root ganglion(DRG)neurons.We have found that vincristine-induced potentiation of PIEZO2 MA currents is due to the enhancement of static plasma membrane tension(SPMT)of these cells following vincristine treatment.Reducing SPMT of DRG neurons by cytochalasin D(CD),a disruptor of the actin filament,abolishes vincristine-induced potentiation of PIEZO2 MA currents,and suppresses vincristine-induced mechanical hypersensitivity in rats.Collectively,enhancing SPMT and subsequently potentiating PIEZO2 MA currents in primary afferent neurons may be an underlying mechanism responsible for vincristineinduced mechanical allodynia and hyperalgesia in rats.Targeting to inhibit PIEZO2 channels may be an effective analgesic method to attenuate vincristine-induced mechanical hypersensitivity.
文摘AIM:Vincristine is one of the most commonly used chemotherapeutic drugs to treat a variety of malignant diseases,including leukemia and lymphoma.Studies have shown that vincristine cause painful effects,whereas Salvia officinalis(SO) showed analgesic and anti-inflammatory effects.The aim of this study is to investigate the effects of the SO hydro-alcoholic extract on vincristine-induced peripheral neuropathy in mice in comparison with morphine.METHODS:Experiments were performed on 60 NMRI male mice weighing 25-30 g divided into six groups.The individual groups received normal saline,SO hydro-alcoholic extract,vincristine,SO hydro-alcoholic extract and vincristine(12 days before formalin test),morphine,and vincristine and morphine,respectively.The injected hind paw biting and licking was measured in a 5-minute interval for one hour.RESULTS:The results showed that formalin induce significant(P < 0.05) pain responses(the first phase:0-5 min and the second phase:15-40 min after injection).Administration of SO extract before formalin test showed significant(P < 0.05) decrease of pain response in the second phase.Administration of vincristine caused significant(P < 0.05) increase in the second phase of pain response.Injections of SO extract and vincristine showed that SO significantly(P < 0.05) decrease the second phase of vincristine-induced pain.Morphine decreased vincristine-induced pain in the first and second phase of formalin test significantly(P < 0.05).In comparison,morphine showed analgesic effects in the first phase and SO extract showed significant(P < 0.05) anti-inflammatory effects in the second phase of formalin test.CONCLUSION:Both SO and vincristine showed analgesic and painful neuropathic effects,suggesting that SO extract could be useful in the treatment of vincristine-induced peripheral neuropathic pain.
文摘An innovative molecularly imprinted electrochemical sensor was fabricated based on reduced graphene oxide (RGO) and gold nanocomposite (Au) for rapid detection of vincristine (VCR). The RGO-Au composite membrane was obtained via direct one-step electrodeposition technique of graphene oxide (GO) and chloroauric acid (HAuCl4) on the surface of a glassy carbon electrode (GCE) by means of cyclic voltammetry (CV) in the potential range be- tween -1.5 and 0.6 V in phosphate buffer solution (PBS) of pH 9.18, which is capable of effectively utilizing its superior electrical conductivity, larger specific surface area due to its synergistic effect between RGO and Au. The molecularly imprinted polymers (MIPs) were synthesized on the RGO-Au modified glassy carbon electrode surface with VCR as the template molecular, methyl acrylic acid (MAA) as the functional monomer, and ethylene glycol maleic rosinate acrylate (EGMRA) as a cross-linker. The performance of the sensor was investigated by cyclic voltammetry (CV), differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS) in de- tail. Under the optimum conditions, the fabricated sensor exhibited a linear relationship between oxidation peak current and VCR concentration over the range of 5.0×10 8 5.0×10^-6 mol.L l with a correlation coefficient of 0.9952 and a detection limit (S/N=3) of 2.6×10 8 mol.L^-1. The results indicated that the imprinted polymer films exhibited an excellent selectivity for VCR. The imprinted sensor was successfully used to determine VCR in real samples with recoveries of 90%-- 120% by using the standard addition method.
文摘Primary gastric choriocarcinoma is a rapidly growing neoplasm with an average survival of several months in untreated patients.Gastrectomy with lymph node dissection followed by chemotherapy is the treatment of choice.Regimens used for gastric adenocarcinoma are usually selected.However,median survival remains less than six months.In this case report,we describe a case of primary gastric choriocarcinoma with a clinical complete response to multidisciplinary treatment including surgery,chemotherapy,and radiofrequency ablation(RFA).The patient was originally referred for general malaise.Esophagogastroduodenoscopy demonstrated a large tumor occupying the fornix,and total gastrectomy with lymph node dissection was performed.Seven days later,multiple liver metastatic recurrences with high serum levels of beta-human chorionic gonadotropin(β-hCG) were recognized.Chemotherapy with a gonadal choriocarcinoma regimen consisting of etoposide,methotrexate,actinomycin D,cyclophosphamide,and vincristine(EMA/CO),was initiated.After three cycles,serum β-hCG decreased markedly and the tumors disappeared.Six months later,multiple lung metastatic recurrences were found.After one cycle of EMA/CO,only one nodule remained.Computed tomography-guided RFA was performed for this oligometastatic tumor.The patient has been alive with no evidence of disease for 10 years after the initial diagnosis.To the best of our knowledge,this patient with recurrent primary gastric choriocarcinoma has achieved the longest survival.The present case is the first report of choriocarcinoma metastatic to the lung successfully treated with RFA.From our retrospective analysis of recurrent or unresectable primary gastric choriocarcinoma,we propose that gonadal choriocarcinoma regimens can be considered as first-line for primary gastric choriocarcinoma.
文摘Primary gastric lymphomas(PGLs)are distinct lymphoproliferative neoplasms described as heterogeneous entities clinically and molecularly.Their main histological types are diffuse large B-cell lymphoma(DLBCL)or mucosaassociated lymphoma tissue.PGL has been one of the main fields of clinical research of our group in recent years.Although gastric DLBCLs are frequent,sufficient data to guide optimal care are scarce.Until today,a multidisciplinary approach has been applied,including chemotherapy,surgery,radiotherapy or a combination of these treatments.In this minireview article,we provide an overview of the clinical manifestations,diagnosis and staging of these diseases,along with their molecular pathogenesis and the most important related clinical published series.We then discuss the scientific gaps,perils and pitfalls that exist regarding the aforementioned studies,in parallel with the unmet need for future research and comment on the proper methodology for such retrospective studies.Aiming to fill this gap,we retrospectively evaluated the trends in clinical presentation,management and outcome among 165 patients with DLBCL PGL who were seen in our institutions in 1980-2014.The study cohort was divided into two subgroups,comparing the main 2 therapeutic options[cyclophosphamide doxorubicin vincristine prednisone(CHOP)vs rituximab-CHOP(R-CHOP)].A better outcome with immunochemotherapy(R-CHOP)was observed.In the next 2 mo,we will present the update of our study with the same basic conclusion.
基金supported by Science and Technology research Project of Zhengzhou City(121PPTGG499-2)
文摘Objective:To study the influence of curcumin on chemosensitivity of nephroblastoma cells.Methods:Human nephroblastoma cells line SK-NEP-1 was transplanted to the nude mice subcutaneously to establish the implantation tumor model of human nephroblastoma cells.A total of 30 tumor-bearing mice were divided into three groups of ten randomly.The routine chemotherapy group was given vincristine(0.05 mg/mL·0.2 mL/d) and actinomycin D(15 ng/mL·0.2 mL/d) combined chemotherapy regime.The curcumin chemotherapy group was given the same combined chemotherapy regimens and curcumin(30 mg/kg/d) by intraperitoneal injection.The control group was given normal saline(NS) of the same volume by intraperitoneal injection.Continuous administration would be kept for 4 weeks and 3 days a week.The volumetric changes of every group were recorded.The serum of every group in different time was collected and the VEGF content was detected by ELISA.All mice were cercrificed and the tumor tissues were stripped and weighed after 4 weeks’ treatment.The tumor inhibition rate was calculated.The cell proliferation activity and apoptosis rate were detected by MTT and flow cytometry method.All data were statistically analyzed by SPSS 19.0.Results:The tumor volume,serum VEGF content,tumor inhibition rate,cell proliferation activity and apoptosis rate of routine chemotherapy group and curcumin chemotherapy group had significant differences comparing with the control group(P<0.05) after 4-week’s treatment.The cancer growth of curcumin chemotherapy group was obviously decreased and even tended to shrink comparing with routine chemotherapy group(χ2=15.732,P=0.007).The cell proliferation activity was significantly reduced and the apoptosis rate was significantly higher,(χ~2=9.427,P=0.012)which showing the effect of chemotherapy was enhanced.Conclusions:The chemosensitivity of nephroblastoma cells could be improved by curcumin,then the effect of preoperative adjuvant chemotherapy scheme would be enhanced,the growth of nephroblastoma cells would be inhibited and the surgical risk of nephroblastoma would be reduced.
文摘A plasmid expressing antisense MDRl cDNAsegment was introduced into KB<sub>v200</sub> which inductedmultiple drugs to VCT (vincristine, 175 fold-resistancehigher than that in original KB cells) and ADM(adriamycin, 14. 5 fold) resulting over-expression ofMDRl. We used the primers for antisense RNA asfollowing: upstream 5′OGAATTCTGAAACCTGTAAGCAGCAACC 3′: downstream
基金supported by Suzhou Science and Technology Development Plan (SKJYD2021047)the Fundation of Suzhou Kowloon Hospital (SZJL202111 and SZJL202104)
文摘Objective:To explore the mechanism of drug resistance in acute lymphoblastic leukemia and the anti-tumor effect of combination therapy of dehydroabietic acid and vincristine against acute lymphoblastic leukemia cells.Methods:Acute lymphoblastic leukemia cells REH and CCRFCEM were employed to detect the anti-tumor effect of vincristine and doxorubicin on proliferation and apoptosis using EdU assay,human active caspase-3 Quantikine ELISA kit,and flow cytometry.Vincristine-resistant REH cells(REH-R),survivin knockdown and overexpressing REH cells were established to verify the role of survivin in drug resistance.Additionally,in vitro and in vivo assays were performed to determine the effect of dehydroabietic acid on the cytotoxicity of vincristine.Results:Vincristine and doxorubicin markedly suppressed proliferation and induced apoptosis of REH and CCRF-CEM cells.Survivin expression was upregulated in REH-R cells compared with REH cells.Knockdown of survivin expression obviously restored the sensitivity of REH-R cells to vincristine.Akt phosphorylation was also increased in REH-R cells compared to REH cells.In addition,LY294002,a PI3k/Akt pathway blocker,inhibited survivin expression and enhanced cytotoxicity of vincristine to REH-R cells.Dehydroabietic acid effectively reduced survivin expression in REH-R cells,thereby enhancing the therapeutic effect of vincristine on drug-resistant cells.Survivin overexpression markedly reduced the effect of dehydroabietic acid on enhancing the anti-proliferation and inducing apoptosis effect of vincristine.Moreover,the combination of dehydroabietic acid with vincristine significantly extended the survival rate in a mouse xenograft model of acute lymphoblastic leukemia,compared with vincristine treatment alone.Conclusions:Dehydroabietic acid may be used as a potential candidate for the treatment of acute lymphoblastic leukemia in combination with vincristine.
文摘Objective To evaluate the efficacy and safety of etoposide, methotrexate, actinomycin D, vincristine and cyclophosphamide (EMA/CO) therapy for gestational trophoblastic tumor (GTT). Methods Medical records of all patients with low risk, middle risk and high risk GTT receiving EMA/CO regimen chemotherapy were analyzed retrospectively. Results\ Twenty one low risk and fourteen middle risk GTT received EMA/CO with 100% remission, six patients with high risk GTT received EMA/CO with 83% complete response and with 17% partial response; Gastrointestinal, hematologic and hepatic toxicity, as well as shed of hair is predictable, mild and reversible. Conclusion\ At present EMA/CO chemotherapy is the choice of our treatment for patients with high, middle and low risk GTT.\;
文摘A male Japanese spitz(3 years)was brought at Himalayan Animal Rescue Trust(HART),Pokhara with a complaint of swollen gums and loss of appetite.A lobulated tumorous mass was seen at the gingival region on physical examination.Diagnosis and treatment of condition detected in the dog was the major objective.Impression smear of tumor cell was prepared and was observed under oil immersion microscope(100x).Microscopic examination shows the presence of vacuolations within the cytoplasm and the condition was diagnosed to be CTVT.Chemotherapy was performed using the most effective cytostatic agents I.e.Vincristine sulphate(once a week,I/v).The chemotherapy was repeated for 3 doses till the tumor gets completely regressed.The condition was resolved after third session of chemotherapy.Myelosuppression and gastrointestinal effects like vomiting are the major complications of using vincristine.