Objective The present study aimed to test whether exposure to radiofrequency electromagnetic fields （RF-EMF） emitted by mobile phone base stations may have effects on salivary alpha-amylase, immunoglobulin A （IgA）...Objective The present study aimed to test whether exposure to radiofrequency electromagnetic fields （RF-EMF） emitted by mobile phone base stations may have effects on salivary alpha-amylase, immunoglobulin A （IgA）, and cortisol levels. Methods Fifty seven participants were randomly allocated to one of three different experimental scenarios （22 participants to scenario 1, 26 to scenario 2, and 9 to scenario 3）. Each participant went through five 50-minute exposure sessions. The main RF-EMF source was a GSM-900-MHz antenna located at the outer wall of the building. In scenarios 1 and 2, the first, third, and fifth sessions were ＂low＂ （median power flux density 5.2 μW/m^2） exposure. The second session was ＂high＂ （2126.8 μW/m^2）, and the fourth session was ＂medium＂ （153.6 μW/m^2） in scenario 1, and vice versa in scenario 2. Scenario 3 had four ＂low＂ exposure conditions, followed by a ＂high＂ exposure condition. Biomedical parameters were collected by saliva samples three times a session. Exposure levels were created by shielding curtains. Results In scenario 3 from session 4 to session 5 （from ＂low＂ to ＂high＂ exposure）, an increase of cortisol was detected, while in scenarios 1 and 2, a higher concentration of alpha-amylase related to the baseline was identified as compared to that in scenario 3. IgA concentration was not significantly related to the exposure. Conclusions RF-EMF in considerably lower field densities than ICNIRP-gnidelines may influence certain psychobiological stress markers.展开更多
Chronic spontaneous urticaria (CSU) is defined as the spontaneous appearance of wheals, angioedema, or both, for at least 6 weeks, due to known or unknown causes [1]. In some patients who present a CSU with daily or a...Chronic spontaneous urticaria (CSU) is defined as the spontaneous appearance of wheals, angioedema, or both, for at least 6 weeks, due to known or unknown causes [1]. In some patients who present a CSU with daily or almost daily symptoms a type I allergy could be the underlying cause. We present one adult patient with chronic urticaria who was finally diagnosed as a non-occupational case of IgE-mediated wheat allergy manifested following exposure by 3 different routes: inhalation (rhinitis and bronchial asthma), dermal absorption (contact urticaria) and ingestion (systemic chronic urticaria). We were able to detect the culprit proteins by immunoblotting. Serum IgE binds mainly to alpha-amylase/trypsin inhibitors and, to a lesser extent, to other proteins associated with food allergy to grains (e.g. beta-glucanase, serpin, peroxidase). In our opinion, skin prick tests with a food standard battery could help in the etiological diagnosis of chronic urticaria. The identification of responsible allergens could be difficult because only a few complex in vitro techniques allow detecting the allergy to several proteins.展开更多
Previous studies have shown that changes in salivary alpha-amylase (sAA) levels are dependent on psychosocial stress stimulation and reflect the activity of the sympathetic nervous system. sAA measurement can be perfo...Previous studies have shown that changes in salivary alpha-amylase (sAA) levels are dependent on psychosocial stress stimulation and reflect the activity of the sympathetic nervous system. sAA measurement can be performed easily and quickly;therefore, it may be useful for evaluating psychosocial or physical stress. The aim of this preliminary study was to examine the use of sAA measurements as objective indicators of psychological and physiological stress levels by examining sAA changes in volunteers subjected to conditions similar to those suffered by children with severe motor and intellectual disabilities and cerebral paralysis. Twelve healthy volunteers were required to not move or speak, as is found in patients suffering from total paralysis, for 30 min. Saliva samples were taken at three points, and sAA activity was measured using a hand-held monitor before the test, immediately after the test, and 10 min after the test. In the present study, a marked increase in sAA activity due to physiological stress and a rapid return to the baseline level were observed. Many subjects felt bodily pain and psychotic discomfort. This measurement method is useful for evaluating stress in children with severe motor and intellectual disabilities, who can not fully express their emotions or communicate with their caregivers.展开更多
Purpose: Several studies have demonstrated that the measurement of salivary alpha-amylase (sAA) levels is a useful tool for evaluating the autonomic nervous system. Psychosocial stress increases the release of sAA as ...Purpose: Several studies have demonstrated that the measurement of salivary alpha-amylase (sAA) levels is a useful tool for evaluating the autonomic nervous system. Psychosocial stress increases the release of sAA as a useful marker for autonomic nervous system (ANS). To our knowledge, although some studies have evaluated sAA levels under psychosocial stress, no studies have investigated the changes in sAA activity that occur in junior high school students who are not attending school due to social anxiety disorder (SAD). We aimed to investigate the relationship between the sAA levels and psychiatric states of such patients. Methods: The study subjects consisted of SAD patients (n = 39) and healthy controls (n = 57). We used a portable hand-held monitor to measure the level of sAA and State-Trait Anxiety Index (STAI) to evaluate the psychiatric state. Results: The patients’ sAA activity was significantly higher than that of the controls (n = 57) (p < 0.001). Significant differences in heart rate (HR) (76.10 ± 11.96 vs. 68.69 ± 10.61, respectively, p < 0.01) and STAI scores (both the STAI-State and STAI-Trait scores) (49.35 ± 10.57 vs. 41.24 ± 8.59, respectively, p < 0.01;55.69 ± 10.44 vs. 45.61 ± 9.36, respectively, p < 0.001) were detected between the patients and healthy controls. Conclusions: These results indicated that junior high school students with SAD exhibit a higher state of anxiety and high autonomic activity, probably due to changes in the sympathetic nervous system. As a result, junior high school students with SAD are expected to exhibit high levels of sAA accompanied by anxiety symptoms.展开更多
This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
Two sampling devices that allow saliva collection through absorption to a cotton roll (Salivette?-method) or to small cotton pellets (VectaSpinTM Micro [VSM]-method) were studied. Any loss of salivary alpha-amylase (s...Two sampling devices that allow saliva collection through absorption to a cotton roll (Salivette?-method) or to small cotton pellets (VectaSpinTM Micro [VSM]-method) were studied. Any loss of salivary alpha-amylase (sAA) activity in relation to the saliva volume absorbed and harvested by centrifugation was examined. A pooled saliva sample prepared from stimulated whole saliva (collected by drooling) of 30 subjects was used. Three different saliva volumes (2.9 ml, 1.5 ml, and 0.8 ml) were tested on cotton rolls and two (0.03 ml, and 0.015 ml) on cotton pellets. The sample sAA activity was determined from the hydrolysis of 2-chloro-4-nitrophenyl-α-D-maltotrioside. In comparison with the original drooling sample, no sAA loss was observed in 1.5 ml samples tested with Salivette, while a significant decrease of activity was recorded with smaller volumes. VSM collected samples showed a non-volume dependent decrease of sAA activity of about 25%. Salivette requires large saliva volumes to allow an accurate sAA estimation. With cases of limited saliva access, VSM may be a suitable sampling device.展开更多
The present study is concerned with the isolation and screening of different strains of Aspergillus oryzae for the production of alpha amylase. Ninety strains were isolated from soil and tested for the production of a...The present study is concerned with the isolation and screening of different strains of Aspergillus oryzae for the production of alpha amylase. Ninety strains were isolated from soil and tested for the production of alpha amylase in shake flasks. Of all the strains tested, Aspergillus oryzae GCB-32 and Aspergillus oryzae GCB-35 gave maximum production of alpha amylase. Different culture media were screened for the production of alpha amylase by these two strains. M1 medium containing starch, yeast extract, NH4Cl, MgSO4·7H2O and CaCl2 gave the maximum production of alpha amylase by both the strains Aspergillus oryzae GCB-32 and Aspergillus oryzae GCB-35.Kinetic analysis revealed that the values of product yield coefficient（Y p/x ） and specific product yield coefficient（qp） were found highly significant（p≤0.05） when medium M1 was used for the enzyme production.展开更多
基金funded by the Land Salzburg Federal Government,Science Department,and Mr.Daniell Porsche,Chairman of the Paracelsus-School at St.Jakob am Thurn,Salzburg,Austria.
文摘Objective The present study aimed to test whether exposure to radiofrequency electromagnetic fields （RF-EMF） emitted by mobile phone base stations may have effects on salivary alpha-amylase, immunoglobulin A （IgA）, and cortisol levels. Methods Fifty seven participants were randomly allocated to one of three different experimental scenarios （22 participants to scenario 1, 26 to scenario 2, and 9 to scenario 3）. Each participant went through five 50-minute exposure sessions. The main RF-EMF source was a GSM-900-MHz antenna located at the outer wall of the building. In scenarios 1 and 2, the first, third, and fifth sessions were ＂low＂ （median power flux density 5.2 μW/m^2） exposure. The second session was ＂high＂ （2126.8 μW/m^2）, and the fourth session was ＂medium＂ （153.6 μW/m^2） in scenario 1, and vice versa in scenario 2. Scenario 3 had four ＂low＂ exposure conditions, followed by a ＂high＂ exposure condition. Biomedical parameters were collected by saliva samples three times a session. Exposure levels were created by shielding curtains. Results In scenario 3 from session 4 to session 5 （from ＂low＂ to ＂high＂ exposure）, an increase of cortisol was detected, while in scenarios 1 and 2, a higher concentration of alpha-amylase related to the baseline was identified as compared to that in scenario 3. IgA concentration was not significantly related to the exposure. Conclusions RF-EMF in considerably lower field densities than ICNIRP-gnidelines may influence certain psychobiological stress markers.
文摘Chronic spontaneous urticaria (CSU) is defined as the spontaneous appearance of wheals, angioedema, or both, for at least 6 weeks, due to known or unknown causes [1]. In some patients who present a CSU with daily or almost daily symptoms a type I allergy could be the underlying cause. We present one adult patient with chronic urticaria who was finally diagnosed as a non-occupational case of IgE-mediated wheat allergy manifested following exposure by 3 different routes: inhalation (rhinitis and bronchial asthma), dermal absorption (contact urticaria) and ingestion (systemic chronic urticaria). We were able to detect the culprit proteins by immunoblotting. Serum IgE binds mainly to alpha-amylase/trypsin inhibitors and, to a lesser extent, to other proteins associated with food allergy to grains (e.g. beta-glucanase, serpin, peroxidase). In our opinion, skin prick tests with a food standard battery could help in the etiological diagnosis of chronic urticaria. The identification of responsible allergens could be difficult because only a few complex in vitro techniques allow detecting the allergy to several proteins.
文摘Previous studies have shown that changes in salivary alpha-amylase (sAA) levels are dependent on psychosocial stress stimulation and reflect the activity of the sympathetic nervous system. sAA measurement can be performed easily and quickly;therefore, it may be useful for evaluating psychosocial or physical stress. The aim of this preliminary study was to examine the use of sAA measurements as objective indicators of psychological and physiological stress levels by examining sAA changes in volunteers subjected to conditions similar to those suffered by children with severe motor and intellectual disabilities and cerebral paralysis. Twelve healthy volunteers were required to not move or speak, as is found in patients suffering from total paralysis, for 30 min. Saliva samples were taken at three points, and sAA activity was measured using a hand-held monitor before the test, immediately after the test, and 10 min after the test. In the present study, a marked increase in sAA activity due to physiological stress and a rapid return to the baseline level were observed. Many subjects felt bodily pain and psychotic discomfort. This measurement method is useful for evaluating stress in children with severe motor and intellectual disabilities, who can not fully express their emotions or communicate with their caregivers.
文摘Purpose: Several studies have demonstrated that the measurement of salivary alpha-amylase (sAA) levels is a useful tool for evaluating the autonomic nervous system. Psychosocial stress increases the release of sAA as a useful marker for autonomic nervous system (ANS). To our knowledge, although some studies have evaluated sAA levels under psychosocial stress, no studies have investigated the changes in sAA activity that occur in junior high school students who are not attending school due to social anxiety disorder (SAD). We aimed to investigate the relationship between the sAA levels and psychiatric states of such patients. Methods: The study subjects consisted of SAD patients (n = 39) and healthy controls (n = 57). We used a portable hand-held monitor to measure the level of sAA and State-Trait Anxiety Index (STAI) to evaluate the psychiatric state. Results: The patients’ sAA activity was significantly higher than that of the controls (n = 57) (p < 0.001). Significant differences in heart rate (HR) (76.10 ± 11.96 vs. 68.69 ± 10.61, respectively, p < 0.01) and STAI scores (both the STAI-State and STAI-Trait scores) (49.35 ± 10.57 vs. 41.24 ± 8.59, respectively, p < 0.01;55.69 ± 10.44 vs. 45.61 ± 9.36, respectively, p < 0.001) were detected between the patients and healthy controls. Conclusions: These results indicated that junior high school students with SAD exhibit a higher state of anxiety and high autonomic activity, probably due to changes in the sympathetic nervous system. As a result, junior high school students with SAD are expected to exhibit high levels of sAA accompanied by anxiety symptoms.
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
文摘Two sampling devices that allow saliva collection through absorption to a cotton roll (Salivette?-method) or to small cotton pellets (VectaSpinTM Micro [VSM]-method) were studied. Any loss of salivary alpha-amylase (sAA) activity in relation to the saliva volume absorbed and harvested by centrifugation was examined. A pooled saliva sample prepared from stimulated whole saliva (collected by drooling) of 30 subjects was used. Three different saliva volumes (2.9 ml, 1.5 ml, and 0.8 ml) were tested on cotton rolls and two (0.03 ml, and 0.015 ml) on cotton pellets. The sample sAA activity was determined from the hydrolysis of 2-chloro-4-nitrophenyl-α-D-maltotrioside. In comparison with the original drooling sample, no sAA loss was observed in 1.5 ml samples tested with Salivette, while a significant decrease of activity was recorded with smaller volumes. VSM collected samples showed a non-volume dependent decrease of sAA activity of about 25%. Salivette requires large saliva volumes to allow an accurate sAA estimation. With cases of limited saliva access, VSM may be a suitable sampling device.
文摘The present study is concerned with the isolation and screening of different strains of Aspergillus oryzae for the production of alpha amylase. Ninety strains were isolated from soil and tested for the production of alpha amylase in shake flasks. Of all the strains tested, Aspergillus oryzae GCB-32 and Aspergillus oryzae GCB-35 gave maximum production of alpha amylase. Different culture media were screened for the production of alpha amylase by these two strains. M1 medium containing starch, yeast extract, NH4Cl, MgSO4·7H2O and CaCl2 gave the maximum production of alpha amylase by both the strains Aspergillus oryzae GCB-32 and Aspergillus oryzae GCB-35.Kinetic analysis revealed that the values of product yield coefficient（Y p/x ） and specific product yield coefficient（qp） were found highly significant（p≤0.05） when medium M1 was used for the enzyme production.
