This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
Primers and probes were established according to the sequences of the alpha-amylase genes of Bacillus. halodurans C-125, Therrnus sp. IM6501, B. stearothermophilus ET-1, and B, acidopullulytics. Primers were designed ...Primers and probes were established according to the sequences of the alpha-amylase genes of Bacillus. halodurans C-125, Therrnus sp. IM6501, B. stearothermophilus ET-1, and B, acidopullulytics. Primers were designed and a 0.2 kb DNA fragment was amplified, the fragment was successfully used for the detection of the amylase Ⅱ gene in a 2 842 bp region from Bacillus halodurans strain 38C1-1.展开更多
For the last decade, low serum amylase(hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes(regardless of type), and metabolic syndrome, all of which appear to have ...For the last decade, low serum amylase(hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes(regardless of type), and metabolic syndrome, all of which appear to have a common etiology of insufficient insulin action due to insulin resistance and/or diminished insulin secretion. Some clinical studies have shown that salivary amylase may be preferentially decreased in obese individuals, whereas others have revealed that pancreatic amylase may be preferentially decreased in diabetic subjects with insulin dependence. Despite this accumulated evidence, the clinical relevance of serum, salivary, and pancreatic amylase and the underlying mechanisms have not been fully elucidated. In recent years, copy number variations(CNVs) in the salivary amylase gene(AMY1), which range more broadly than the pancreatic amylase gene(AMY2A and AMY2B), have been shown to be well correlated with salivary and serum amylase levels. In addition, low CNV of AMY1, indicating low salivary amylase, was associated with insulin resistance, obesity, low taste perception/satiety, and postprandial hyperglycemia through impaired insulin secretion at early cephalic phase. In most populations, insulin-dependent diabetes is less prevalent(minor contribution) compared with insulin-independent diabetes, and obesity is highly prevalent compared with low body weight. Therefore, obesity as a condition that elicits cardiometabolic diseases relating to insulin resistance(major contribution) may be a common determinant for low serum amylase in a general population. In this review, the novel interpretation of low serum, salivary, and pancreas amylase is discussed in terms of major contributions of obesity, diabetes, and metabolic syndrome.展开更多
Construction of a food-grade expression vector for application to lactic acid bacteria（LAB） is of importance for dairy fermentation system. An α-galactosidase（aga） gene encoding an enzyme degrading melibiose was ...Construction of a food-grade expression vector for application to lactic acid bacteria（LAB） is of importance for dairy fermentation system. An α-galactosidase（aga） gene encoding an enzyme degrading melibiose was amplified by PCR from the plasmid p RAF800 of Lactococcus lactis NZ9000. The aga gene was introduced into pMG36 e to substitute the p rimary antibiotic selectable marker of pMG36 e, resulting in construction of a new food-grade expression vector pMG36-aga. To testify the expression efficiency of exogenous gene in pMG36-aga, a 1.5 kb long α-amylase（amy） gene from Ba cillus li cheniformis was cloned by PCR and introduced into the plasmid pMG36-aga. The resultant plasimd pMG36-aga-amy was transformed into L. lactis ML23 by electroporation. The positive clones were selected with the medium containing melibiose as the sole carbon source. Th e selection efficiency of aga was 8.71×103 CFU with a standard deviation of 9.1×102 CFU ？g-1 DNA of pMG36-aga. Furthermore, the SDS-PAGE analysis showed that the pMG36-aga-amy expressed a 56.4 kDa protein which was the same as the putati ve molecular weight of α-amylase. The starch plate assay also indicated that L. lactis ML23 displayed high activity of α-amylase by expressing of amy gene of pMG36-aga-amy.展开更多
Maltodextrin is a significant ingredient extensively used in food industries,but its application is limited due to uneven polymerization and high reducibility.Hence,preparation of nonreducing maltodextrin with narrow ...Maltodextrin is a significant ingredient extensively used in food industries,but its application is limited due to uneven polymerization and high reducibility.Hence,preparation of nonreducing maltodextrin with narrow distribution of DP is essential.A dual-enzyme cascade enzymatic reaction for preparing nonreducing maltoheptaose(N-G7)is feasible via recombinant cyclomaltodextrinase(EC 3.2.1.54,CDase)and maltooligosyltrehalose synthase(EC 5.4.99.15,MTSase)heterologously overexpressed in Escherichia coli BL21(DE3).However,during this process,N-G7 further was hydrolyzed into small molecule maltooligosaccharides by the amylases homologously expressed in the host.In this study,twoα-amylase genes(ycjM and malS)were deleted to avoid host hydrolysis in N-G7 via CRISPR/Cas9 system.Gene deletion had a significant decrease on the yield of maltooligosaccharides of 5 and 6 glucose units.The defective strainsΔycjM andΔycjM-ΔmalS increased the yield of N-G7 by 21.94%and 25.47%,correspondingly.Marginal impact was made in cell growth and protein secretion of the host.YcjM and MalS were overexpressed inΔycjM-ΔmalS and the hydrolytic activity of YcjM was twice that of MalS.They constituted a complex multiple hydrolysis system for N-G7 with the Mal series enzymes involved in a maltose system in the host.展开更多
The cloning of α amylase gene of S. occidentalis and the construction of starch digestible strain of yeast, S. cerevisiae AS. 2.1364 with ethanol tolerance and without auxotrophic markers used in fermentation industr...The cloning of α amylase gene of S. occidentalis and the construction of starch digestible strain of yeast, S. cerevisiae AS. 2.1364 with ethanol tolerance and without auxotrophic markers used in fermentation industry were studied. The yeast/ E.coli shuttle plasmid YCEp1 partial library of S. occidentalis DNA was constructed and α amylase gene was screened in S. cerevisiae by amylolytic activity. Several transformants with amylolysis were obtained and one of the fusion plasmids had an about 5.0 kb inserted DNA fragment, containing the upstream and downstream sequences of α amylase gene from S. occidentalis . It was further confirmed by PCR and sequence determination that this 5.0 kb DNA fragment contains the whole coding sequence of α amylase. The amylolytic test showed that when this transformant was incubated on plate of YPDS medium containing 1% glucose and 1% starch at 30℃ for 48 h starch degradation zones could be visualized by staining with iodine vapour. α amylase activity of the culture filtratate is 740\780 mU/mL and PAGE shows that the yeast harboring fusion plasmids efficiently secreted α amylase into the medium, and the amount of the recombinant α amylase is more than 12% of the total proteins in the culture filtrate. These results showed that α amylase gene can be highly expressed and efficiently secreted in S. cerevisiae AS. 2.1364, and the promotor and the terminator of α amylase gene from S. occidentalis work well in S. cerevisiae AS.2.1364.展开更多
The secretive expression vector has been constructed using the promoter and signal se-quence of yeast MF-α1 factor,and the Bacillus licheniformis α-amylase gene without promoter and signal se-quence has been inserte...The secretive expression vector has been constructed using the promoter and signal se-quence of yeast MF-α1 factor,and the Bacillus licheniformis α-amylase gene without promoter and signal se-quence has been inserted into the downstream of the signal sequence on the vector.After the readjustment ofthe reading frame,the amylase gene was expressed in Saccharomyces cerevisiae and the product was secretedfrom it.The properties of enzymes secreted from yeast and B.subtilis are compared,and the mechanism ofthe gene expression and product secretion are discussed.展开更多
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
基金Natural Science Foundation of Heilongjiang Province (C9912)
文摘Primers and probes were established according to the sequences of the alpha-amylase genes of Bacillus. halodurans C-125, Therrnus sp. IM6501, B. stearothermophilus ET-1, and B, acidopullulytics. Primers were designed and a 0.2 kb DNA fragment was amplified, the fragment was successfully used for the detection of the amylase Ⅱ gene in a 2 842 bp region from Bacillus halodurans strain 38C1-1.
文摘For the last decade, low serum amylase(hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes(regardless of type), and metabolic syndrome, all of which appear to have a common etiology of insufficient insulin action due to insulin resistance and/or diminished insulin secretion. Some clinical studies have shown that salivary amylase may be preferentially decreased in obese individuals, whereas others have revealed that pancreatic amylase may be preferentially decreased in diabetic subjects with insulin dependence. Despite this accumulated evidence, the clinical relevance of serum, salivary, and pancreatic amylase and the underlying mechanisms have not been fully elucidated. In recent years, copy number variations(CNVs) in the salivary amylase gene(AMY1), which range more broadly than the pancreatic amylase gene(AMY2A and AMY2B), have been shown to be well correlated with salivary and serum amylase levels. In addition, low CNV of AMY1, indicating low salivary amylase, was associated with insulin resistance, obesity, low taste perception/satiety, and postprandial hyperglycemia through impaired insulin secretion at early cephalic phase. In most populations, insulin-dependent diabetes is less prevalent(minor contribution) compared with insulin-independent diabetes, and obesity is highly prevalent compared with low body weight. Therefore, obesity as a condition that elicits cardiometabolic diseases relating to insulin resistance(major contribution) may be a common determinant for low serum amylase in a general population. In this review, the novel interpretation of low serum, salivary, and pancreas amylase is discussed in terms of major contributions of obesity, diabetes, and metabolic syndrome.
基金supported by the National High-Tech R&D Program of China (863 Program, 2006AA10Z317)
文摘Construction of a food-grade expression vector for application to lactic acid bacteria（LAB） is of importance for dairy fermentation system. An α-galactosidase（aga） gene encoding an enzyme degrading melibiose was amplified by PCR from the plasmid p RAF800 of Lactococcus lactis NZ9000. The aga gene was introduced into pMG36 e to substitute the p rimary antibiotic selectable marker of pMG36 e, resulting in construction of a new food-grade expression vector pMG36-aga. To testify the expression efficiency of exogenous gene in pMG36-aga, a 1.5 kb long α-amylase（amy） gene from Ba cillus li cheniformis was cloned by PCR and introduced into the plasmid pMG36-aga. The resultant plasimd pMG36-aga-amy was transformed into L. lactis ML23 by electroporation. The positive clones were selected with the medium containing melibiose as the sole carbon source. Th e selection efficiency of aga was 8.71×103 CFU with a standard deviation of 9.1×102 CFU ？g-1 DNA of pMG36-aga. Furthermore, the SDS-PAGE analysis showed that the pMG36-aga-amy expressed a 56.4 kDa protein which was the same as the putati ve molecular weight of α-amylase. The starch plate assay also indicated that L. lactis ML23 displayed high activity of α-amylase by expressing of amy gene of pMG36-aga-amy.
基金supported by the National Natural Science Foundation of China[grant number 31871745]Major Science and Technology Innovation Project of Shandong Province[grant number 2020CXGC010601].
文摘Maltodextrin is a significant ingredient extensively used in food industries,but its application is limited due to uneven polymerization and high reducibility.Hence,preparation of nonreducing maltodextrin with narrow distribution of DP is essential.A dual-enzyme cascade enzymatic reaction for preparing nonreducing maltoheptaose(N-G7)is feasible via recombinant cyclomaltodextrinase(EC 3.2.1.54,CDase)and maltooligosyltrehalose synthase(EC 5.4.99.15,MTSase)heterologously overexpressed in Escherichia coli BL21(DE3).However,during this process,N-G7 further was hydrolyzed into small molecule maltooligosaccharides by the amylases homologously expressed in the host.In this study,twoα-amylase genes(ycjM and malS)were deleted to avoid host hydrolysis in N-G7 via CRISPR/Cas9 system.Gene deletion had a significant decrease on the yield of maltooligosaccharides of 5 and 6 glucose units.The defective strainsΔycjM andΔycjM-ΔmalS increased the yield of N-G7 by 21.94%and 25.47%,correspondingly.Marginal impact was made in cell growth and protein secretion of the host.YcjM and MalS were overexpressed inΔycjM-ΔmalS and the hydrolytic activity of YcjM was twice that of MalS.They constituted a complex multiple hydrolysis system for N-G7 with the Mal series enzymes involved in a maltose system in the host.
文摘The cloning of α amylase gene of S. occidentalis and the construction of starch digestible strain of yeast, S. cerevisiae AS. 2.1364 with ethanol tolerance and without auxotrophic markers used in fermentation industry were studied. The yeast/ E.coli shuttle plasmid YCEp1 partial library of S. occidentalis DNA was constructed and α amylase gene was screened in S. cerevisiae by amylolytic activity. Several transformants with amylolysis were obtained and one of the fusion plasmids had an about 5.0 kb inserted DNA fragment, containing the upstream and downstream sequences of α amylase gene from S. occidentalis . It was further confirmed by PCR and sequence determination that this 5.0 kb DNA fragment contains the whole coding sequence of α amylase. The amylolytic test showed that when this transformant was incubated on plate of YPDS medium containing 1% glucose and 1% starch at 30℃ for 48 h starch degradation zones could be visualized by staining with iodine vapour. α amylase activity of the culture filtratate is 740\780 mU/mL and PAGE shows that the yeast harboring fusion plasmids efficiently secreted α amylase into the medium, and the amount of the recombinant α amylase is more than 12% of the total proteins in the culture filtrate. These results showed that α amylase gene can be highly expressed and efficiently secreted in S. cerevisiae AS. 2.1364, and the promotor and the terminator of α amylase gene from S. occidentalis work well in S. cerevisiae AS.2.1364.
基金the State"7.5"Key ProjectScience and Technology Commision of Guangdong Province,China
文摘The secretive expression vector has been constructed using the promoter and signal se-quence of yeast MF-α1 factor,and the Bacillus licheniformis α-amylase gene without promoter and signal se-quence has been inserted into the downstream of the signal sequence on the vector.After the readjustment ofthe reading frame,the amylase gene was expressed in Saccharomyces cerevisiae and the product was secretedfrom it.The properties of enzymes secreted from yeast and B.subtilis are compared,and the mechanism ofthe gene expression and product secretion are discussed.
