This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
In the perifused fura-2 loaded exocrine pancreatic acinar cell line AR4-2J pulses of high potassium induced repetitive increases in intracellular calcium. Attached cells when stimulated with high potassium secreted la...In the perifused fura-2 loaded exocrine pancreatic acinar cell line AR4-2J pulses of high potassium induced repetitive increases in intracellular calcium. Attached cells when stimulated with high potassium secreted large amount of amylase. High potassium-induced secretion was dependent both on the concentration of potassium and duration of stimulation. High potassium induced increases in intracellular calcium were inhibited by voltage-dependent calcium channel antagonists with an order of potency as follows: nifedipine > ω-agatoxin IVA > ω-conotoxin GVIA. In contrast, the L-type calcium channel antagonist nifedipine almost completely inhibited potassium-induced amylase secretion, whereas the N-type channel antagonist ω-conotoxin GVIA was without effect. The P-type channel antagonist ω-agatoxin IVA had a small inhibitory effect, but this inhibition was not significant at the level of amylase secretion. In conclusion, the AR4-2J cell line possesses different voltage-dependent calcium channels (L, P,N) with the L-type predominantly involved in depolarization induced amylase secretion.展开更多
Twenty-seven antarctic bacteria producing extracellular polysaccharide （EPS） were selected from 57 strains by staining technology. The effects of major environmental factors on the growth and EPS production of Pseud...Twenty-seven antarctic bacteria producing extracellular polysaccharide （EPS） were selected from 57 strains by staining technology. The effects of major environmental factors on the growth and EPS production of Pseudoalteromonas sp. S - 15 - 13 were investigated, and the EPS was separated and purified for characterization analysis. The results showed that the optimal conditions for the EPS production were culture period, 56 h; growth temperature, 8 ℃ ; carbon source, 1.0% glucose; NaCI concentration, 3.0% ; pH 6.0 - 7.0. The EPS was purified by cold ethanol precipitation, proteins removal, ion exchange chromatography and gel chromatography technology. The molecular mass of EPS - H was 62 kDa as determined by the high performance gel permeation chromatography. Its sugar composition was a homopolymer of marmose analyzed by gas chromatograph spectroscopy. After repeated freezing and thawing of the bacteria hiomass in the presence of EPS, the bacterial growth was much higher than that observed after freezing in the absence of EPS and the difference augmented with the increase of freeze-thaw cycles. It is hypothesized that the adaptation of Pseudoalteromonas sp. S- 15 - 13 to the antarctic marine conditions, characterized by low temperature, high NaCl concentration and repeated freeze-thaw cycles, might be related to the EPS production ability.展开更多
[Objective]The study aimed to screen the starch-degrading bacterium in bagasse and carry on the identification of strains s2g5-1 and s3g4-8.[Method]By using a variety of selective media,varieties of starch degrading b...[Objective]The study aimed to screen the starch-degrading bacterium in bagasse and carry on the identification of strains s2g5-1 and s3g4-8.[Method]By using a variety of selective media,varieties of starch degrading bacterium were isolated from the sugar cane bagasse form different stages of natural fermentation,then,primary screening and secondary screening were performed.[Result] Starch-degrading strains s2g5-1 and s3g4-8 were screened,and they were identified as Bacillus amyloliquefaciens according to their morphological,physiological,biochemical and molecular characteristics.[Conclusion]The research provided theoretical basis for factory application of bagasse.展开更多
The present study was aimed to assess the ability of Bacillus sp.JDM-2-1 and Staphylococcus capitis to reduce hexavalent chromium into its trivalent form.Bacillus sp.JDM-2-1 could tolerate Cr（Ⅵ）（4800 μg/mL） and ...The present study was aimed to assess the ability of Bacillus sp.JDM-2-1 and Staphylococcus capitis to reduce hexavalent chromium into its trivalent form.Bacillus sp.JDM-2-1 could tolerate Cr（Ⅵ）（4800 μg/mL） and S.capitis could tolerate Cr（Ⅵ）（2800 μg/mL）.Both organisms were able to resist Cd^2＋（50 μg/mL）,Cu^2＋（200 μg/mL）,Pb^2＋（800 μg/mL）,Hg^2＋（50 μg/mL） and Ni2＋（4000 μg/mL）.S.capitis resisted Zn^2＋ at 700 μg/mL while Bacillus sp.JDM-2-1 only showed resistance up to 50 μg/mL.Bacillus sp.JDM-2-1 and S.capitis showed optimum growth at pH 6 and 7,respectively,while both bacteria showed optimum growth at 37°C.Bacillus sp.JDM-2-1 and S.capitis could reduce 85% and 81% of hexavalent chromium from the medium after 96 h and were also capable of reducing hexavalent chromium 86% and 89%,respectively,from the industrial effuents after 144 h.Cell free extracts of Bacillus sp.JDM-2-1 and S.capitis showed reduction of 83% and 70% at concentration of 10 μg Cr（Ⅵ）/mL,respectively.The presence of an induced protein having molecular weight around 25 kDa in the presence of chromium points out a possible role of this protein in chromium reduction.The bacterial isolates can be exploited for the bioremediation of hexavalent chromium containing wastes,since they seem to have a potential to reduce the toxic hexavalent form to its nontoxic trivalent form.展开更多
A serious sandstorm occurred in North China from April 5 to April 7, 2000, while the remote smallsand decending took place in even larger area to the far northeast China. In Chanchun city, smallsand descending with sn...A serious sandstorm occurred in North China from April 5 to April 7, 2000, while the remote smallsand decending took place in even larger area to the far northeast China. In Chanchun city, smallsand descending with snow provides the best samples to conduct a quantitative research on the possible impacts of city - ecology. In the 253km2 urban district area of Changchun city, smallsands accumulated up to more than 3000t on April 7, according to the calculation of four "mud - snow" samples. After naturally melting in room temperature, two samples are taken to do quarantine of "invasion bacteria". As a preliminary result, the individual amount of bacterium in 1 ml sample water is up to 8. 9 x 104 or 1. 05 x 105, and it is estimated that there are 640 million "invasion bacterium" individuals in one square meter. This study proves that other than the obvious environmental effects of sandstorm, the urban micro - ecosystem is very possible under threat by the "invasion bacterium" accompanied by remote descending smallsand.展开更多
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
文摘In the perifused fura-2 loaded exocrine pancreatic acinar cell line AR4-2J pulses of high potassium induced repetitive increases in intracellular calcium. Attached cells when stimulated with high potassium secreted large amount of amylase. High potassium-induced secretion was dependent both on the concentration of potassium and duration of stimulation. High potassium induced increases in intracellular calcium were inhibited by voltage-dependent calcium channel antagonists with an order of potency as follows: nifedipine > ω-agatoxin IVA > ω-conotoxin GVIA. In contrast, the L-type calcium channel antagonist nifedipine almost completely inhibited potassium-induced amylase secretion, whereas the N-type channel antagonist ω-conotoxin GVIA was without effect. The P-type channel antagonist ω-agatoxin IVA had a small inhibitory effect, but this inhibition was not significant at the level of amylase secretion. In conclusion, the AR4-2J cell line possesses different voltage-dependent calcium channels (L, P,N) with the L-type predominantly involved in depolarization induced amylase secretion.
文摘Twenty-seven antarctic bacteria producing extracellular polysaccharide （EPS） were selected from 57 strains by staining technology. The effects of major environmental factors on the growth and EPS production of Pseudoalteromonas sp. S - 15 - 13 were investigated, and the EPS was separated and purified for characterization analysis. The results showed that the optimal conditions for the EPS production were culture period, 56 h; growth temperature, 8 ℃ ; carbon source, 1.0% glucose; NaCI concentration, 3.0% ; pH 6.0 - 7.0. The EPS was purified by cold ethanol precipitation, proteins removal, ion exchange chromatography and gel chromatography technology. The molecular mass of EPS - H was 62 kDa as determined by the high performance gel permeation chromatography. Its sugar composition was a homopolymer of marmose analyzed by gas chromatograph spectroscopy. After repeated freezing and thawing of the bacteria hiomass in the presence of EPS, the bacterial growth was much higher than that observed after freezing in the absence of EPS and the difference augmented with the increase of freeze-thaw cycles. It is hypothesized that the adaptation of Pseudoalteromonas sp. S- 15 - 13 to the antarctic marine conditions, characterized by low temperature, high NaCl concentration and repeated freeze-thaw cycles, might be related to the EPS production ability.
基金Supported by the Central Public-interest Scientific Institution Basal Research Fund(2008hzs1J021,2009hzs1J033)~~
文摘[Objective]The study aimed to screen the starch-degrading bacterium in bagasse and carry on the identification of strains s2g5-1 and s3g4-8.[Method]By using a variety of selective media,varieties of starch degrading bacterium were isolated from the sugar cane bagasse form different stages of natural fermentation,then,primary screening and secondary screening were performed.[Result] Starch-degrading strains s2g5-1 and s3g4-8 were screened,and they were identified as Bacillus amyloliquefaciens according to their morphological,physiological,biochemical and molecular characteristics.[Conclusion]The research provided theoretical basis for factory application of bagasse.
文摘The present study was aimed to assess the ability of Bacillus sp.JDM-2-1 and Staphylococcus capitis to reduce hexavalent chromium into its trivalent form.Bacillus sp.JDM-2-1 could tolerate Cr（Ⅵ）（4800 μg/mL） and S.capitis could tolerate Cr（Ⅵ）（2800 μg/mL）.Both organisms were able to resist Cd^2＋（50 μg/mL）,Cu^2＋（200 μg/mL）,Pb^2＋（800 μg/mL）,Hg^2＋（50 μg/mL） and Ni2＋（4000 μg/mL）.S.capitis resisted Zn^2＋ at 700 μg/mL while Bacillus sp.JDM-2-1 only showed resistance up to 50 μg/mL.Bacillus sp.JDM-2-1 and S.capitis showed optimum growth at pH 6 and 7,respectively,while both bacteria showed optimum growth at 37°C.Bacillus sp.JDM-2-1 and S.capitis could reduce 85% and 81% of hexavalent chromium from the medium after 96 h and were also capable of reducing hexavalent chromium 86% and 89%,respectively,from the industrial effuents after 144 h.Cell free extracts of Bacillus sp.JDM-2-1 and S.capitis showed reduction of 83% and 70% at concentration of 10 μg Cr（Ⅵ）/mL,respectively.The presence of an induced protein having molecular weight around 25 kDa in the presence of chromium points out a possible role of this protein in chromium reduction.The bacterial isolates can be exploited for the bioremediation of hexavalent chromium containing wastes,since they seem to have a potential to reduce the toxic hexavalent form to its nontoxic trivalent form.
文摘A serious sandstorm occurred in North China from April 5 to April 7, 2000, while the remote smallsand decending took place in even larger area to the far northeast China. In Chanchun city, smallsand descending with snow provides the best samples to conduct a quantitative research on the possible impacts of city - ecology. In the 253km2 urban district area of Changchun city, smallsands accumulated up to more than 3000t on April 7, according to the calculation of four "mud - snow" samples. After naturally melting in room temperature, two samples are taken to do quarantine of "invasion bacteria". As a preliminary result, the individual amount of bacterium in 1 ml sample water is up to 8. 9 x 104 or 1. 05 x 105, and it is estimated that there are 640 million "invasion bacterium" individuals in one square meter. This study proves that other than the obvious environmental effects of sandstorm, the urban micro - ecosystem is very possible under threat by the "invasion bacterium" accompanied by remote descending smallsand.
