A STUDY ON CONFORMATIONAL STRUCTURE OF MODEL COMPOUND OF NOVEL SIDE CHAIN LIQUID CRYSTALLINE POLYMER BY USING HIGH RESOLUTION SOLID STATE ^(13)C-NMR

^(13)C-NMR chemical shifts of model compound of a novel side chain liquid crystalline polymer, poly 2.5-his (4-alkoxybenzoyloxy) styrene , have been assigned in this study. Moreover, by using high-resolution solid-state CP/MAS (cross polarization/magic angle spinning) technique, the spectrum shows that in the crystalline state the ester linkage has a conformation nearly perpendicular to the either side of ring planes, and that the alkoxy groups are not fully in zigzag form. The possible conformational changes around the mesogens from the solid state to the mesophase are discussed.

Synthesis, Crystal Structure, Fluorescent Property and DFT Calculations of a New Zn(Ⅱ) Complex Based on 3-(2-Pyridyl)-5-(4-pyridyl)-1H-1,2,4-triazole

A new coordination compound Zn（2,4＇-bpt）2（H2O）（1） based on the versatile ligand 2,4＇-Hbpt（2,4？-Hbpt = 3-（2-pyridyl）-5-（4-pyridyl）-1H-1,2,4-triazole） was prepared by hydrothermal reactions. The structure of complex 1 has been characterized by X-ray single-crystal diffraction, elemental analysis, X-ray powder diffraction, IR spectrum analysis and thermogravimetric analysis. Single-crystal X-ray diffraction analysis indicates that the complex belongs to monoclinic system, space group C2/c with a = 23.877（3）, b = 0.7483（9）, c = 1.2492（2） A, b = 92.681（2）°, V = 2230.6（4） A^3, Z = 4, Dc = 1.572 g/cm^3, m = 1.143 mm^-1, Mr = 527.85 and F（000） = 1080. The final R = 0.0581 and wR = 0.0898 with I 〉 2s（I）. 1 is a 0D motif which is connected by hydrogen bonds to form a corrugated 1D pattern. In addition, 1 shows strong photoluminescent emissions in the solid state at room temperature which can be used as potential optical materials. Theoretical calculations based on density functional theory（DFT） were employed in order to explicate the stability and chemical reactivity of 2,4＇-Hbpt with different conformations. The results indicated that conformation I is more stable and prior to coordination in the reactions.

Algebraic Solution for the Forward Displacement Analysis of the General 6-6 Stewart Mechanism

The solution for the forward displacement analysis（FDA） of the general 6-6 Stewart mechanism（i.e., the connection points of the moving and fixed platforms are not restricted to lying in a plane） has been extensively studied, but the efficiency of the solution remains to be effectively addressed. To this end, an algebraic elimination method is proposed for the FDA of the general 6-6 Stewart mechanism. The kinematic constraint equations are built using conformal geometric algebra（CGA）. The kinematic constraint equations are transformed by a substitution of variables into seven equations with seven unknown variables. According to the characteristic of anti-symmetric matrices, the aforementioned seven equations can be further transformed into seven equations with four unknown variables by a substitution of variables using the Grobner basis. Its elimination weight is increased through changing the degree of one variable, and sixteen equations with four unknown variables can be obtained using the Grobner basis. A 40th-degree univariate polynomial equation is derived by constructing a relatively small-sized 9 × 9 Sylvester resultant matrix. Finally, two numerical examples are employed to verify the proposed method. The results indicate that the proposed method can effectively improve the efficiency of solution and reduce the computational burden because of the small-sized resultant matrix.

The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.

Depolymerization of <i>α</i>- &<i>β</i>-Chitosan by <i>e</i>-Beam Irradiation

α- and β-chitosan with molecular weight of 190,000 and 800,000 respectively, were depolymerized by e-beam irradiation with various doses. The radiation yield of scission (Gs) and degradation rate of the chitosans were identified. The synergistic chemical degradation in the presence of hydrogen peroxide is more effective at lower doses. Mw of β-chitosan was dramatically decreased from 800,000 to 21,030 at the irradiation dose 5 kGy, on the other hand, that of α-chitosan was decreased much more gradually from 190,000 to 36,000. The values of Gs at 10 kGy in the solution without H2O2 and with H2O2 were respectively 6.09 × 10-5 mol/cal and 30.6 × 10-5 mol/cal for α-Chitosan, and 8.18 × 10-5 mol/cal and 43.8 × 10-5 mol/cal for β-chitosan. It was obviously effective on depolymerization by using the combination of e-beam and H2O2. α-Chitosan molecules are likely to adopt a diffuse conformation in the solution and make the different morphologies depending on the concentration.

Synthesis, Structure and Quantum Mechanical Calculations of Methyl 2-(5-((Quinolin-8-yloxy)-methyl)-1,3,4-oxadiazol-2-ylthio)-acetate

The title compound was synthesized by the base catalyzed reaction of 5-（（quinolin- 8-yloxy）methyl）-1,3,4-oxadiazole-2（3H）-thione with methyl chloroacetate. The structure was supported by the spectroscopic data and unambiguously confirmed by single-crystal X-ray diffraction studies. It crystallizes from a methanol solution in the triclinic space group Pi with unit cell dimensions a = 7.4509（9）, b = 10.2389（12）, c = 12.2299（15）A, a = 74.771（2）, β = 77.956（2）, 7 = 69.263（2）°, V = 834.98（17） A3 and Z = 2. In order to gain some valuable insights into the molecular structure, the quantum mechanical calculations were performed using both HF and time-dependent density functional theory at the B3LYP/6-31G（d,p） level. The molecular geometry from X-ray determination of the title compound in the ground state has been compared using the Hartree-Fock （HF） and density functional theory （DFT） with the 6-31G（d） basis set. The calculated results show that the DFT and HF can well reproduce the structure of the title compound. The energetic behavior of the title compound was examined using the B3LYP method with the 6-31G（d） basis set. The harmonic vibrational frequencies calculated have been compared with the experimental FTIR and FT-Raman spectra. The restricted Hartree-Fock and density functional theory-based nuclear magnetic resonance （NMR） calculation procedure was also performed, and it was used for assigning the 13C and 1H NMR chemical shifts of the title compound. Moreover, molecular electrostatic potential and thermodynamic parameters of the title compound were investigated by theoretical calculations.

Density-Dependent Conformable Space-time Fractional Diffusion-Reaction Equation and Its Exact Solutions

In this article, a special type of fractional differential equations(FDEs) named the density-dependent conformable fractional diffusion-reaction(DDCFDR) equation is studied. Aforementioned equation has a significant role in the modelling of some phenomena arising in the applied science. The well-organized methods, including the exp(-φ(ε))-expansion and modified Kudryashov methods are exerted to generate the exact solutions of this equation such that some of the solutions are new and have been reported for the first time. Results illustrate that both methods have a great performance in handling the DDCFDR equation.

DOW CORNING 1-2577 Conformal Coating as an efficient diffusion material for cathode in the microbial fuel cell

In this study, DOW CORNING 1-2577 Con- formal Coating was proposed for the cathode diffusion layer of the microbial fuel cell （MFC）. In MFCs, stainless steel mesh cathodes using DOW CORN1NG 1-2577 Conformal Coating/carbon as the diffusion layer and two poly （dimethylsiloxane） （PDMS）/carbon diffusion layers and carbon cloth cathode with four poly （tetrafluoroethy- lene） （PTFE） diffusion layers were constructed for comparison. Under the same operational condition, the MFCs with the DOW CORNING 1-2577 Conformal Coating/carbon diffusion layer produced the maximum power density of 1585q-52mW-m2, compared with those using poly （tetrafluoroethylene） （PTFE） diffusion layers （1421 ~45 mW. m-2） and poly （dimethylsiloxane） （PDMS）/carbon diffusion layers （13534-49 mW. m-E）. The DOW CORNING 1-2577 Conformal Coating could be an alternative for the diffusion layer construction in the MFC due to its remarkable performance and much simple construction procedure.

Conformation of α,α,α′-Trisubstituted Cyclododecanone

Ten α,α,α′-trisubstituted cyclododecanones were synthesized and characterized by elemental analyses, infrared, 1^H NMR and 13^C NMR spectra, and X-ray diffraction. NMR data could not give conformational information clearly, but some of their ring skeleton conformations of cyclododecanone moiety were showed to remain the unchanged [3333]-2-one conformation with little distortion, while the others were changed to the [3324]-2-one conformation in their crystal structures. These are consistent with the results of molecular mechanics calculation with Sybyl 6.9 software and Tripos force field, and semi-empirical quantum calculation with AM 1 method in Gaussian 98 software. Two geminal substituting groups are located at α-corner carbon atom, and the third group is at α-side-exo carbon atom in both conformations. Both [3333]-2-one and [3324]-2-one conformations are present in a dynamic equilibrium in the solution, but only one preferred conformation exists in the crystal solid.

Synthesis and Supramolecular Assemblies of Tripodal 1,3,5-Tris（phenoxymethyl）-2,4,6-triethylbenzene Analogues

Tripodal 1,3,5-tris（phenoxymethyl）-2,4,6-triethylbenzene analogues have been synthesized and structurally characterized by IR, 1H NMR and 13C NMR spectroscopy and HRMS, and additionally, the single crystal structures of compounds bearing ortho- （7）, meta- （9） and para-hydroxymethyl （11） functions have been determined by X-ray diffraction analysis. The structural study revealed that compounds 7, 9, and II do not adopt the expected 1,3,5-alternate conformation in the solid state. The packing diagrams of compounds 7, 9, and 11 revealed that six hydrophilic hydroxymethyl groups from six individual molecules （7, 9 and 11） were arranged in close contact via intermolecular hydrogen-bond interactions. For compounds 7 and 9, the six hydroxyl groups formed a distorted hexagonal ring; however, formation of such a hexagonal ring was not clear in the case of compound 11. Compounds 9 and 11 were found to form hydrophobic cavities via intermolecular hydrogen-bond interactions in the solid state, and the cavities were occupied by two ethyl groups from the two cavity-forming molecules.

Synthesis and Structural Characteristics of Two Novel Bicyclododecyl Derivatives

2-（2＇-Oxo-3＇-oximidocyclododecyl） cyclododecanone （1） and 2-（1＇-hydroxylcyclododecyl） cyclododecanone （2） were synthesized and characterized. The conformation analysis was carried out based on the NMR, molecular mechanics calculation and X-ray diffraction. The conformation of two cyclododecyl moieties of both 1 and 2 was found to be the [3333]-2-one or [3333] square conformation both in the crystal state and the solution. The dihedral angle between carbonyl and the oxime double bond of the ring B is 180°in the crystal of 1. The protons or hydroxyl group of carbon atoms to link the two cyclododecyl moieties of 1 and 2 constitute dihedral angles of 174°in the crystal, and 175°in the solution, and the C-C 6 bond between two cyclododecyl moieties can not freely rotate in the solid state and the solution. In addition, compound 2 was the first example of a-comer-anti-monosubstituted cyclododecanone. synthesis