Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric ...Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric double- stranded chain system: intrachain interaction, external potential, and mass asymmetric double chains. It is reported that asymmetry is helpful in improving the thermal conductivity of the system. We first propose double-heat flux channels to explain the influence of asymmetric structures on the thermal conductivity. The phonon spectral behaviour and finite size effect are also included.展开更多
A critical challenge hindering the practical application of lithium–oxygen batteries(LOBs)is the inevitable problems associated with liquid electrolytes,such as evaporation and safety problems.Our study addresses the...A critical challenge hindering the practical application of lithium–oxygen batteries(LOBs)is the inevitable problems associated with liquid electrolytes,such as evaporation and safety problems.Our study addresses these problems by proposing a modified polyrotaxane(mPR)-based solid polymer electrolyte(SPE)design that simultaneously mitigates solvent-related problems and improves conductivity.mPR-SPE exhibits high ion conductivity(2.8×10^(−3)S cm^(−1)at 25℃)through aligned ion conduction pathways and provides electrode protection ability through hydrophobic chain dispersion.Integrating this mPR-SPE into solid-state LOBs resulted in stable potentials over 300 cycles.In situ Raman spectroscopy reveals the presence of an LiO_(2)intermediate alongside Li_(2)O_(2)during oxygen reactions.Ex situ X-ray diffraction confirm the ability of the SPE to hinder the permeation of oxygen and moisture,as demonstrated by the air permeability tests.The present study suggests that maintaining a low residual solvent while achieving high ionic conductivity is crucial for restricting the sub-reactions of solid-state LOBs.展开更多
The philosophical concept of one bond connecting the world is an established scientific and economic phenomenon today.The global industrial and supply chains are symbols of that universal link of fraternity,cooperatio...The philosophical concept of one bond connecting the world is an established scientific and economic phenomenon today.The global industrial and supply chains are symbols of that universal link of fraternity,cooperation and globalization.Despite a few major economies still trying to push forward a decoupling agenda and favoring a“small yard,high fence”strategy,globalization and cooperation remain a global trend.展开更多
The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the prese...The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.展开更多
In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondri...In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.展开更多
Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chro...Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chromosomes together until the metaphase I to anaphase I transition, is critical for proper chromosome segregation. Recent studies have suggested that the SPO 11 proteins have conserved functions in a number of organisms in generating sites of double-stranded DNA breaks (DSBs) that are thought to be the starting points of homologous recombination. Processing of these sites of DSBs requires the function of RecA homologs, such as RAD5 1, DMC 1, and others, as suggested by mutant studies; thus the failure to repair these meiotic DSBs results in abnormal chromosomal alternations, leading to disrupted meiosis. Recent discoveries on the functions of these RecA homologs have improved the understanding of the mechanisms underlying meiotic homologous recombination.展开更多
In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA (dsDNA) molecules on Au-layer surface are greatly affected by the mechanical, thermal a...In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA (dsDNA) molecules on Au-layer surface are greatly affected by the mechanical, thermal and electrical properties of DNA biofilm. In this paper, the elastic properties of dsDNA biofilm are studied. First, the Parsegian's empirical potential based on a mesoscopic liq- uid crystal theory is employed to describe the interaction energy among coarse-grained DNA cylinders. Then, con- sidering a Gaussian distribution of DNA interaxial distance, the thought experiment method is used to derive an analyti- cal expression for Young's modulus of DNA biofilm with a stochastic packing pattern for the first time. Results show that Young's modulus of DNA biofilm is on the order of 10 MPa. These findings could provide a simple and effective method to evaluate the mechanical properties of soft biofilm on snbstrate.展开更多
The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work...The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work,molecular dynamics simulations were used to examine the adsorption of different length dsDNA molecules(from 4 bp to24 bp)on the GO surface.The dsDNA molecules could be adsorbed on the GO surface through the terminal bases and stand on the GO surface.For short dsDNA(4 bp)molecules,the double-helix structure was partially or totally broken and the adsorption dynamics was affected by the structural fluctuation of short dsDNA and the distribution of the oxidized groups on the GO surface.For long dsDNA molecules(from 8 bp to 24 bp)adsorption is stable.By nonlinear fitting of the contact angle between the axis of the dsDNA molecule and the GO surface,we found that a dsDNA molecule adsorbed on a GO surface has the chance of orienting parallel to the GO surface if the length of the dsDNA molecule is longer than 54 bp.We attributed this behavior to the flexibility of dsDNA molecules.With increasing length,the flexibility of dsDNA molecules also increases,and this increasing flexibility gives an adsorbed dsDNA molecule more chance of reaching the GO surface with the free terminal.This work provides a whole picture of adsorption of dsDNA molecules on the GO surface and should be of benefit for the design of DNA/GO based biosensors.展开更多
A new coordination compound, [(CuI)(Btd)]n (1, Btd = 2,1,3-benzothiadiazole), was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was charact...A new coordination compound, [(CuI)(Btd)]n (1, Btd = 2,1,3-benzothiadiazole), was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was characterized by elemental analysis, IR spectroscopy, single-crystal X-ray diffraction analysis and photoluminescence. The complex crystallizes in the triclinic Pi space group, with a = 4.1620(6), b = 10.4590(15), c = 10.5052(15) A, a = 69.310(2), β = 83.608(2), γ = 78.873(2)°, V = 419.30(10) A3, Z = 2, C6H4N2SCuI, Mr = 326.61, Dc = 2.587 g/cm^3, F(000) = 304 and/^(MoKa) = 6.464 mm-1. The final R = 0.0418 and wR = 0.0936 for 1451 observed reflections with 1 〉 2σ(I) and R = 0.0422 and wR = 0.0939 for all data. In the complex, the Cu atoms are coordinated by one nitrogen atom and three iodine atoms to form a double-stranded stair, and such stairs are further linked to build a 2D framework via C-H…I interactions.展开更多
Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups (AG's). Many isolates of these fungi contain double-stranded viral RNA...Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups (AG's). Many isolates of these fungi contain double-stranded viral RNA (dsRNA) that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle (M)-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large (L)-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR (RTqPCR) with the primers (reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC) and probe (5' Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3'). The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration (Ct) values using the plasmid cDNA as a template.展开更多
Based on the system dynamic model, a full system dynamics estimation method is proposed for a chain shell magazine driven by a permanent magnet synchronous motor(PMSM). An adaptive extended state observer(AESO) is pro...Based on the system dynamic model, a full system dynamics estimation method is proposed for a chain shell magazine driven by a permanent magnet synchronous motor(PMSM). An adaptive extended state observer(AESO) is proposed to estimate the unmeasured states and disturbance, in which the model parameters are adjusted in real time. Theoretical analysis shows that the estimation errors of the disturbances and unmeasured states converge exponentially to zero, and the parameter estimation error can be obtained from the extended state. Then, based on the extended state of the AESO, a novel parameter estimation law is designed. Due to the convergence of AESO, the novel parameter estimation law is insensitive to controllers and excitation signal. Under persistent excitation(PE) condition, the estimated parameters will converge to a compact set around the actual parameter value. Without PE signal, the estimated parameters will converge to zero for the extended state. Simulation and experimental results show that the proposed method can accurately estimate the unmeasured states and disturbance of the chain shell magazine, and the estimated parameters will converge to the actual value without strictly continuous PE signals.展开更多
This study demonstrates the feasibility and effectiveness of utilizing native soils as a resource for inocula to produce n-caproate through the chain elongation(CE)platform,offering new insights into anaerobic soil pr...This study demonstrates the feasibility and effectiveness of utilizing native soils as a resource for inocula to produce n-caproate through the chain elongation(CE)platform,offering new insights into anaerobic soil processes.The results reveal that all five of the tested soil types exhibit CE activity when supplied with high concentrations of ethanol and acetate,highlighting the suitability of soil as an ideal source for n-caproate production.Compared with anaerobic sludge and pit mud,the native soil CE system exhibited higher selectivity(60.53%),specificity(82.32%),carbon distribution(60.00%),electron transfer efficiency(165.00%),and conductivity(0.59 ms∙cm^(-1)).Kinetic analysis further confirmed the superiority of soil in terms of a shorter lag time and higher yield.A microbial community analysis indicated a positive correlation between the relative abundances of Pseudomonas,Azotobacter,and Clostridium and n-caproate production.Moreover,metagenomics analysis revealed a higher abundance of functional genes in key microbial species,providing direct insights into the pathways involved in n-caproate formation,including in situ CO_(2)utilization,ethanol oxidation,fatty acid biosynthesis(FAB),and reverse beta-oxidation(RBO).The numerous functions in FAB and RBO are primarily associated with Pseudomonas,Clostridium,Rhodococcus,Stenotrophomonas,and Geobacter,suggesting that these genera may play roles that are involved or associated with the CE process.Overall,this innovative inoculation strategy offers an efficient microbial source for n-caproate production,underscoring the importance of considering CE activity in anaerobic soil microbial ecology and holding potential for significant economic and environmental benefits through soil consortia exploration.展开更多
This study delves into the formation dynamics of alliances within a closed-loop supply chain(CLSC)that encom-passes a manufacturer,a retailer,and an e-commerce platform.It leverages Stackelberg game for this explorati...This study delves into the formation dynamics of alliances within a closed-loop supply chain(CLSC)that encom-passes a manufacturer,a retailer,and an e-commerce platform.It leverages Stackelberg game for this exploration,contrasting the equilibrium outcomes of a non-alliance model with those of three differentiated alliance models.The non-alliance model acts as a crucial benchmark,enabling the evaluation of the motivations for various supply chain entities to engage in alliance formations.Our analysis is centered on identifying the most effective alliance strategies and establishing a coordination within these partnerships.We thoroughly investigate the consequences of diverse alliance behaviors,bidirectional free-riding and cost-sharing,and the resultant effects on the optimal decision-making among supply chain actors.The findings underscore several pivotal insights:(1)The behavior of alliances within the supply chain exerts variable impacts on the optimal pricing and demand of its members.In comparison to the non-alliance(D)model,the manufacturer-retailer(MR)and manufacturer-e-commerce platform(ME)alliances significantly lower both offline and online resale prices for new and remanufactured goods.This adjustment leads to an enhanced demand for products via the MR alliance’s offline outlets and the ME alliance’s online platforms,thereby augmenting the profits for those within the alliance.Conversely,retailer-e-commerce platform(ER)alliance tends to increase the optimal retail price and demand across both online and offline channels.Under specific conditions,alliance behavior can also increase the profits of non-alliance members,and the profits derived through alliance channels also exceed those from non-alliance channels.(2)The prevalence of bidirectional free-riding behavior largely remains constant across different alliance configurations.Across these models,bidirectional free-riding typically elevates the equilibrium prices in offline channel while negatively affecting the equilibrium prices in other channel.(3)The effect of cost-sharing shows relative uniformity across the various alliance models.Across all configurations,cost-sharing tends to reduce the manufacturer’s profits.Nonetheless,alliances initiated by the manufacturer can counteract these negative impacts,providing a strategic pathway to bolster CLSC profitability.展开更多
Statistical regression models are input-oriented estimation models that account for observation errors. On the other hand, an output-oriented possibility regression model that accounts for system fluctuations is propo...Statistical regression models are input-oriented estimation models that account for observation errors. On the other hand, an output-oriented possibility regression model that accounts for system fluctuations is proposed. Furthermore, the possibility Markov chain is proposed, which has a disidentifiable state (posterior) and a nondiscriminable state (prior). In this paper, we first take up the entity efficiency evaluation problem as a case study of the posterior non-discriminable production possibility region and mention Fuzzy DEA with fuzzy constraints. Next, the case study of the ex-ante non-discriminable event setting is discussed. Finally, we introduce the measure of the fuzzy number and the equality relation and attempt to model the possibility Markov chain mathematically. Furthermore, we show that under ergodic conditions, the direct sum state can be decomposed and reintegrated using fuzzy OR logic. We had already constructed the Possibility Markov process based on the indifferent state of this world. In this paper, we try to extend it to the indifferent event in another world. It should be noted that we can obtain the possibility transfer matrix by full use of possibility theory.展开更多
Trade credit,as an effective tool for integrating and coordinating material,information,and financial flows in supply chain management,is becoming increasingly widespread.We explore how a manufacturer can design optim...Trade credit,as an effective tool for integrating and coordinating material,information,and financial flows in supply chain management,is becoming increasingly widespread.We explore how a manufacturer can design optimal trade credit contracts when a risk-averse retailer hides its sales cost information(adverse selection)and selling effort level(moral hazard).We develop incentive models for a risk-averse supply chain when adverse selection and moral hazard coexist,which are then compared with the results under single information asymmetry(moral hazard).Moreover,we analyze the effects of private information and risk-aversion coefficient on contract parameters,selling effort level and the profit or utility of the supply chain.The study shows that when the degree of retailer’s risk aversion is within a certain range,reasonable trade credit contracts designed by the manufacturer can effectively induce the retailer to report its real sales cost and encourage it to exert appropriate effort.Furthermore,we find that the optimal trade credit period,optimal transfer payment,and retailer’s optimal sales effort level under dual information asymmetry are less than those under single information asymmetry.Numerical analysis are conducted to demonstrate the effects of the parameters on decisions and profits.展开更多
Due to the rapid progress of information technology, organizations anticipate significant changes in the planning, scheduling, and optimization aspects of operation and supply chain management (SCM) shortly. Two prima...Due to the rapid progress of information technology, organizations anticipate significant changes in the planning, scheduling, and optimization aspects of operation and supply chain management (SCM) shortly. Two primary types of risk have an impact on supply chain management and design. The first group deals with the difficulties in matching supply and demand, whereas the second group deals with disruptions to regular business operations. The essay offers a theoretical framework that combines the cooperative efforts of risk assessment and mitigation, which are critical for effectively handling potential supply chain interruptions. This content provides insightful viewpoints on the strategic resources and operational structure needed to improve organizational success. We utilized the partial least squares (PLS) method to address the problem of multicollinearity and measurement mistakes in examining cause-and-effect constructs. The statistical method, Least Squares (PLS), used in structural equation modeling, is based on partial variance. The Partial Least Squares (PLS) strategy uses a two-stage estimate procedure to calculate weights, loadings, and route estimations. Initially, several simple and complex regressions were performed with the provided model. The procedure was repeated until a solution was found, resulting in a set of weights used to determine the latent variable scores. In the second step, non-iterative PLS regression yields loadings, path coefficients, mean scores, and location parameters. According to the structural study, implementing Sustainable Supply Chain Management (SSCM) can significantly improve a business’s operational and financial performance. The findings offer a comprehensive understanding of several elements of supply chain management (SSCM), including information systems, organizational configurations, supply chain network architecture (SCND), and supply chain strategy (SCS). The supply chain is essential for effectively moving goods over great distances and encouraging cooperation between parties. Therefore, these connections are established precisely, quickly, and cheaply via a knowledgeable and efficient supply chain. Two key components are necessary for a supply chain (SC) to be successful: efficient collaboration and the smooth integration of information-sharing platforms.展开更多
Unlike the traditional decentralized channel,the drop-shipping channel entails a retailer relaying consumers’orders to the manufacturer,which proceeds to stock the orders and directly ship them to the consumers.This ...Unlike the traditional decentralized channel,the drop-shipping channel entails a retailer relaying consumers’orders to the manufacturer,which proceeds to stock the orders and directly ship them to the consumers.This study explores supply chain coordination and product quality in drop-shipping and traditional channels.Specifically,we analyze the performance of both channels under wholesale price and revenue-sharing contracts.Our study yields several key findings.First,the revenue-sharing contract can coordinate both traditional and drop-shipping channels,effectively increasing supply chain performance.Second,given the channel structure,the retailer prefers the wholesale price contract,whereas the manufacturer prefers the revenue-sharing contract.Third,product quality is higher in the drop-shipping channel when demand uncertainty is high.Finally,the implementation of the revenue-sharing contract increases product quality in the traditional channel,whereas it keeps product quality unchanged in the drop-shipping channel.展开更多
Building well-developed ion-conductive highways is highly desirable for anion exchange membranes(AEMs).Grafting side chain is a highly effective approach for constructing a well-defined phaseseparated morphological st...Building well-developed ion-conductive highways is highly desirable for anion exchange membranes(AEMs).Grafting side chain is a highly effective approach for constructing a well-defined phaseseparated morphological structure and forming unblocked ion pathways in AEMs for fast ion transport.Fluorination of side chains can further enhance phase separation due to the superhydrophobic nature of fluorine groups.However,their electronic effect on the alkaline stability of side chains and membranes is rarely reported.Here,fluorine-containing and fluorine-free side chains are introduced into the polyaromatic backbone in proper configuration to investigate the impact of the fluorine terminal group on the stability of the side chains and membrane properties.The poly(binaphthyl-co-p-terphenyl piperidinium)AEM(QBNp TP)has the highest molecular weight and most dimensional stability due to its favorable backbone arrangement among ortho-and meta-terphenyl based AEMs.Importantly,by introducing both a fluorinated piperidinium side chain and a hexane chain into the p-terphenyl-based backbone,the prepared AEM(QBNp TP-QFC)presents an enhanced conductivity(150.6 m S cm^(-1))and a constrained swelling at 80℃.The electronic effect of fluorinated side chains is contemplated by experiments and simulations.The results demonstrate that the presence of strong electro-withdrawing fluorine groups weakens the electronic cloud of adjacent C atoms,increasing OH^(-)attack on the C atom and improving the stability of piperidinium cations.Hence QBNp TP-QFC possesses a robust alkaline stability at 80℃(95.3%conductivity retention after testing in 2 M Na OH for 2160 h).An excellent peak power density of 1.44 W cm^(-2)and a remarkable durability at 80℃(4.5%voltage loss after 100 h)can be observed.展开更多
It has been demonstrated that almost all polymer-clay nanocomposites show higher temperature stability than that of pure polymer, which is attributed to the active exfoliated clay nanosheet firmly adsorbed onto the po...It has been demonstrated that almost all polymer-clay nanocomposites show higher temperature stability than that of pure polymer, which is attributed to the active exfoliated clay nanosheet firmly adsorbed onto the polymer chains, due to polerization and nucleation effect, the clay nanosheets could protect the polymer chains from destroying. To prove such mechanism, the water-soluble polymer nanocomposites(AAA/SLS-MMT) were synthesized by the in-situ polymerization of 2-acrylamide-2-methyl-propane sulfonic acid, acrylamide, 4-acryloylmorpholine, and organically modified montmorillonite. The techniques of nuclear magnetic resonance, atomic force microscopy and scanning electron microscopy etc., clearly characterized the successful synthesized of sample's structure, the exfoliated MMT nanosheet adsorbed polymer chain's scale, and well-dispersed morphology, espectively. The adsorption model, X-ray photoelectron spectroscopy presented the existence of strong adsorption, while molecular simulation calculations first concluded that the strong adsorption energy was-13032.06 kcal/mol. Thermo-gravimetric-analysis proved the temperature of maximum thermal degradation of powder sample(AAA/1.0 wt% SLS-MMT) was over 298℃. After ageing at 180℃ for 4 h, the apparent viscosity of 5 g/L AAA/1.0 wt% SLS-MMT aqueous solution was 326.7 mPa,s, while that of pure polymer(AAA) was only 8.3 mPa,s. This optimized sample has the smallest FLAPIvalue at all test temperatures from 180 to 220℃ in both fresh and salt water based drilling fluid. All the evidences of high temperature resistance indicate that the strong adsorption can enhance the thickness of hydrated shell and adsorption of clay particles in drilling fluid at high temperature. Such mechanism supplied the better way to design high-temperature resistant fluid loss additives for deep and ultra-deep oil and gas formation engineering.展开更多
Owing to the persisting hype in pushing toward global carbon neutrality,the study scope of atmospheric science is rapidly expanding.Among numerous trending topics,energy meteorology has been attracting the most attent...Owing to the persisting hype in pushing toward global carbon neutrality,the study scope of atmospheric science is rapidly expanding.Among numerous trending topics,energy meteorology has been attracting the most attention hitherto.One essential skill of solar energy meteorologists is solar power curve modeling,which seeks to map irradiance and auxiliary weather variables to solar power,by statistical and/or physical means.In this regard,this tutorial review aims to deliver a complete overview of those fundamental scientific and engineering principles pertaining to the solar power curve.Solar power curves can be modeled in two primary ways,one of regression and the other of model chain.Both classes of modeling approaches,alongside their hybridization and probabilistic extensions,which allow accuracy improvement and uncertainty quantification,are scrutinized and contrasted thoroughly in this review.展开更多
基金supported in part by the National Natural Science Foundation of China (Grant No. 11004082)the Natural Science Foundation of Guangdong Province of China (Grant No. 01005249)the Fundamental Research Funds for the Central Universities of China (Grant No. 21609305)
文摘Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric double- stranded chain system: intrachain interaction, external potential, and mass asymmetric double chains. It is reported that asymmetry is helpful in improving the thermal conductivity of the system. We first propose double-heat flux channels to explain the influence of asymmetric structures on the thermal conductivity. The phonon spectral behaviour and finite size effect are also included.
基金supported by a National Research Foundation of Korea(NRF)Grant funded by the Ministry of Science and ICT(2021R1A2C1014294,2022R1A2C3003319)the BK21 FOUR(Fostering Outstanding Universities for Research)through the National Research Foundation(NRF)of Korea.
文摘A critical challenge hindering the practical application of lithium–oxygen batteries(LOBs)is the inevitable problems associated with liquid electrolytes,such as evaporation and safety problems.Our study addresses these problems by proposing a modified polyrotaxane(mPR)-based solid polymer electrolyte(SPE)design that simultaneously mitigates solvent-related problems and improves conductivity.mPR-SPE exhibits high ion conductivity(2.8×10^(−3)S cm^(−1)at 25℃)through aligned ion conduction pathways and provides electrode protection ability through hydrophobic chain dispersion.Integrating this mPR-SPE into solid-state LOBs resulted in stable potentials over 300 cycles.In situ Raman spectroscopy reveals the presence of an LiO_(2)intermediate alongside Li_(2)O_(2)during oxygen reactions.Ex situ X-ray diffraction confirm the ability of the SPE to hinder the permeation of oxygen and moisture,as demonstrated by the air permeability tests.The present study suggests that maintaining a low residual solvent while achieving high ionic conductivity is crucial for restricting the sub-reactions of solid-state LOBs.
文摘The philosophical concept of one bond connecting the world is an established scientific and economic phenomenon today.The global industrial and supply chains are symbols of that universal link of fraternity,cooperation and globalization.Despite a few major economies still trying to push forward a decoupling agenda and favoring a“small yard,high fence”strategy,globalization and cooperation remain a global trend.
文摘The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.
文摘In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.
基金The authors thank Alexandra Surcel and Carey L Hendrix Lord for helpful comments on this manuscript.The work in our laboratory is supported by grants from the National Science Foundation(IBN-0077832,MCB-9896340,MCB-0092075)the National Institutes of Health(R0 1 GM63871)+3 种基金the US Department of Agriculture(2001-35301-10570 and 2003-35301-13313)Wuxing L was partially supported by the Intercollege Graduate Degree Program in Plant PhysiologyHong M gratefully acknowledges the support of the John Simon Guggenheim Foundationthe National Institutes of Health(F33 GM72245-1).
文摘Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chromosomes together until the metaphase I to anaphase I transition, is critical for proper chromosome segregation. Recent studies have suggested that the SPO 11 proteins have conserved functions in a number of organisms in generating sites of double-stranded DNA breaks (DSBs) that are thought to be the starting points of homologous recombination. Processing of these sites of DSBs requires the function of RecA homologs, such as RAD5 1, DMC 1, and others, as suggested by mutant studies; thus the failure to repair these meiotic DSBs results in abnormal chromosomal alternations, leading to disrupted meiosis. Recent discoveries on the functions of these RecA homologs have improved the understanding of the mechanisms underlying meiotic homologous recombination.
基金supported by the National Natural Science Foundation of China(11272193 and 10872121)the Shanghai Leading Academic Discipline Project(S30106)
文摘In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA (dsDNA) molecules on Au-layer surface are greatly affected by the mechanical, thermal and electrical properties of DNA biofilm. In this paper, the elastic properties of dsDNA biofilm are studied. First, the Parsegian's empirical potential based on a mesoscopic liq- uid crystal theory is employed to describe the interaction energy among coarse-grained DNA cylinders. Then, con- sidering a Gaussian distribution of DNA interaxial distance, the thought experiment method is used to derive an analyti- cal expression for Young's modulus of DNA biofilm with a stochastic packing pattern for the first time. Results show that Young's modulus of DNA biofilm is on the order of 10 MPa. These findings could provide a simple and effective method to evaluate the mechanical properties of soft biofilm on snbstrate.
基金Project supported by the National Natural Science Foundation of China (Grant No.11974366)the Fundamental Research Funds for the Central Universities+2 种基金Chinathe Supercomputer Center of the Chinese Academy of Sciencesthe Shanghai Supercomputer Center of China。
文摘The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work,molecular dynamics simulations were used to examine the adsorption of different length dsDNA molecules(from 4 bp to24 bp)on the GO surface.The dsDNA molecules could be adsorbed on the GO surface through the terminal bases and stand on the GO surface.For short dsDNA(4 bp)molecules,the double-helix structure was partially or totally broken and the adsorption dynamics was affected by the structural fluctuation of short dsDNA and the distribution of the oxidized groups on the GO surface.For long dsDNA molecules(from 8 bp to 24 bp)adsorption is stable.By nonlinear fitting of the contact angle between the axis of the dsDNA molecule and the GO surface,we found that a dsDNA molecule adsorbed on a GO surface has the chance of orienting parallel to the GO surface if the length of the dsDNA molecule is longer than 54 bp.We attributed this behavior to the flexibility of dsDNA molecules.With increasing length,the flexibility of dsDNA molecules also increases,and this increasing flexibility gives an adsorbed dsDNA molecule more chance of reaching the GO surface with the free terminal.This work provides a whole picture of adsorption of dsDNA molecules on the GO surface and should be of benefit for the design of DNA/GO based biosensors.
基金Supported by the National Natural Science Foundation of China (61205184)the Department of Education of Zhejiang Province (Y201122207)+1 种基金Open Foundation of Zhejiang Provincial Top Key Academic Discipline of Applied Chemistry and Eco-Dyeing & Finishing Engineering (YR2012013)the Young Researchers Foundation of Zhejiang Provincial Top Key Academic Discipline of Applied Chemistry and Eco-Dyeing & Finishing Engineering (ZYG2012003)
文摘A new coordination compound, [(CuI)(Btd)]n (1, Btd = 2,1,3-benzothiadiazole), was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was characterized by elemental analysis, IR spectroscopy, single-crystal X-ray diffraction analysis and photoluminescence. The complex crystallizes in the triclinic Pi space group, with a = 4.1620(6), b = 10.4590(15), c = 10.5052(15) A, a = 69.310(2), β = 83.608(2), γ = 78.873(2)°, V = 419.30(10) A3, Z = 2, C6H4N2SCuI, Mr = 326.61, Dc = 2.587 g/cm^3, F(000) = 304 and/^(MoKa) = 6.464 mm-1. The final R = 0.0418 and wR = 0.0936 for 1451 observed reflections with 1 〉 2σ(I) and R = 0.0422 and wR = 0.0939 for all data. In the complex, the Cu atoms are coordinated by one nitrogen atom and three iodine atoms to form a double-stranded stair, and such stairs are further linked to build a 2D framework via C-H…I interactions.
文摘Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups (AG's). Many isolates of these fungi contain double-stranded viral RNA (dsRNA) that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle (M)-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large (L)-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR (RTqPCR) with the primers (reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC) and probe (5' Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3'). The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration (Ct) values using the plasmid cDNA as a template.
文摘Based on the system dynamic model, a full system dynamics estimation method is proposed for a chain shell magazine driven by a permanent magnet synchronous motor(PMSM). An adaptive extended state observer(AESO) is proposed to estimate the unmeasured states and disturbance, in which the model parameters are adjusted in real time. Theoretical analysis shows that the estimation errors of the disturbances and unmeasured states converge exponentially to zero, and the parameter estimation error can be obtained from the extended state. Then, based on the extended state of the AESO, a novel parameter estimation law is designed. Due to the convergence of AESO, the novel parameter estimation law is insensitive to controllers and excitation signal. Under persistent excitation(PE) condition, the estimated parameters will converge to a compact set around the actual parameter value. Without PE signal, the estimated parameters will converge to zero for the extended state. Simulation and experimental results show that the proposed method can accurately estimate the unmeasured states and disturbance of the chain shell magazine, and the estimated parameters will converge to the actual value without strictly continuous PE signals.
基金supported by the National Natural Science Foundation of China(52000132 and 51978201)Open Project of State Key Laboratory of Urban Water Resource and Environment,Harbin Institute of Technology(HC202241)the Fundamental Research Funds for the Central Universities.
文摘This study demonstrates the feasibility and effectiveness of utilizing native soils as a resource for inocula to produce n-caproate through the chain elongation(CE)platform,offering new insights into anaerobic soil processes.The results reveal that all five of the tested soil types exhibit CE activity when supplied with high concentrations of ethanol and acetate,highlighting the suitability of soil as an ideal source for n-caproate production.Compared with anaerobic sludge and pit mud,the native soil CE system exhibited higher selectivity(60.53%),specificity(82.32%),carbon distribution(60.00%),electron transfer efficiency(165.00%),and conductivity(0.59 ms∙cm^(-1)).Kinetic analysis further confirmed the superiority of soil in terms of a shorter lag time and higher yield.A microbial community analysis indicated a positive correlation between the relative abundances of Pseudomonas,Azotobacter,and Clostridium and n-caproate production.Moreover,metagenomics analysis revealed a higher abundance of functional genes in key microbial species,providing direct insights into the pathways involved in n-caproate formation,including in situ CO_(2)utilization,ethanol oxidation,fatty acid biosynthesis(FAB),and reverse beta-oxidation(RBO).The numerous functions in FAB and RBO are primarily associated with Pseudomonas,Clostridium,Rhodococcus,Stenotrophomonas,and Geobacter,suggesting that these genera may play roles that are involved or associated with the CE process.Overall,this innovative inoculation strategy offers an efficient microbial source for n-caproate production,underscoring the importance of considering CE activity in anaerobic soil microbial ecology and holding potential for significant economic and environmental benefits through soil consortia exploration.
基金This work was supported by the Humanities and Social Science Fund of Ministry of Education of China(No.20YJA630009)Shandong Natural Science Foundation of China(No.ZR2022MG002).
文摘This study delves into the formation dynamics of alliances within a closed-loop supply chain(CLSC)that encom-passes a manufacturer,a retailer,and an e-commerce platform.It leverages Stackelberg game for this exploration,contrasting the equilibrium outcomes of a non-alliance model with those of three differentiated alliance models.The non-alliance model acts as a crucial benchmark,enabling the evaluation of the motivations for various supply chain entities to engage in alliance formations.Our analysis is centered on identifying the most effective alliance strategies and establishing a coordination within these partnerships.We thoroughly investigate the consequences of diverse alliance behaviors,bidirectional free-riding and cost-sharing,and the resultant effects on the optimal decision-making among supply chain actors.The findings underscore several pivotal insights:(1)The behavior of alliances within the supply chain exerts variable impacts on the optimal pricing and demand of its members.In comparison to the non-alliance(D)model,the manufacturer-retailer(MR)and manufacturer-e-commerce platform(ME)alliances significantly lower both offline and online resale prices for new and remanufactured goods.This adjustment leads to an enhanced demand for products via the MR alliance’s offline outlets and the ME alliance’s online platforms,thereby augmenting the profits for those within the alliance.Conversely,retailer-e-commerce platform(ER)alliance tends to increase the optimal retail price and demand across both online and offline channels.Under specific conditions,alliance behavior can also increase the profits of non-alliance members,and the profits derived through alliance channels also exceed those from non-alliance channels.(2)The prevalence of bidirectional free-riding behavior largely remains constant across different alliance configurations.Across these models,bidirectional free-riding typically elevates the equilibrium prices in offline channel while negatively affecting the equilibrium prices in other channel.(3)The effect of cost-sharing shows relative uniformity across the various alliance models.Across all configurations,cost-sharing tends to reduce the manufacturer’s profits.Nonetheless,alliances initiated by the manufacturer can counteract these negative impacts,providing a strategic pathway to bolster CLSC profitability.
文摘Statistical regression models are input-oriented estimation models that account for observation errors. On the other hand, an output-oriented possibility regression model that accounts for system fluctuations is proposed. Furthermore, the possibility Markov chain is proposed, which has a disidentifiable state (posterior) and a nondiscriminable state (prior). In this paper, we first take up the entity efficiency evaluation problem as a case study of the posterior non-discriminable production possibility region and mention Fuzzy DEA with fuzzy constraints. Next, the case study of the ex-ante non-discriminable event setting is discussed. Finally, we introduce the measure of the fuzzy number and the equality relation and attempt to model the possibility Markov chain mathematically. Furthermore, we show that under ergodic conditions, the direct sum state can be decomposed and reintegrated using fuzzy OR logic. We had already constructed the Possibility Markov process based on the indifferent state of this world. In this paper, we try to extend it to the indifferent event in another world. It should be noted that we can obtain the possibility transfer matrix by full use of possibility theory.
基金supported by the Plan Project of Shanghai Philosophy and Social Science(2017BGL014)the National Natural Science Foundation of China(71832001)the Fundamental Research Funds for the Central Universities(2232020B-04,2232018H-07).
文摘Trade credit,as an effective tool for integrating and coordinating material,information,and financial flows in supply chain management,is becoming increasingly widespread.We explore how a manufacturer can design optimal trade credit contracts when a risk-averse retailer hides its sales cost information(adverse selection)and selling effort level(moral hazard).We develop incentive models for a risk-averse supply chain when adverse selection and moral hazard coexist,which are then compared with the results under single information asymmetry(moral hazard).Moreover,we analyze the effects of private information and risk-aversion coefficient on contract parameters,selling effort level and the profit or utility of the supply chain.The study shows that when the degree of retailer’s risk aversion is within a certain range,reasonable trade credit contracts designed by the manufacturer can effectively induce the retailer to report its real sales cost and encourage it to exert appropriate effort.Furthermore,we find that the optimal trade credit period,optimal transfer payment,and retailer’s optimal sales effort level under dual information asymmetry are less than those under single information asymmetry.Numerical analysis are conducted to demonstrate the effects of the parameters on decisions and profits.
文摘Due to the rapid progress of information technology, organizations anticipate significant changes in the planning, scheduling, and optimization aspects of operation and supply chain management (SCM) shortly. Two primary types of risk have an impact on supply chain management and design. The first group deals with the difficulties in matching supply and demand, whereas the second group deals with disruptions to regular business operations. The essay offers a theoretical framework that combines the cooperative efforts of risk assessment and mitigation, which are critical for effectively handling potential supply chain interruptions. This content provides insightful viewpoints on the strategic resources and operational structure needed to improve organizational success. We utilized the partial least squares (PLS) method to address the problem of multicollinearity and measurement mistakes in examining cause-and-effect constructs. The statistical method, Least Squares (PLS), used in structural equation modeling, is based on partial variance. The Partial Least Squares (PLS) strategy uses a two-stage estimate procedure to calculate weights, loadings, and route estimations. Initially, several simple and complex regressions were performed with the provided model. The procedure was repeated until a solution was found, resulting in a set of weights used to determine the latent variable scores. In the second step, non-iterative PLS regression yields loadings, path coefficients, mean scores, and location parameters. According to the structural study, implementing Sustainable Supply Chain Management (SSCM) can significantly improve a business’s operational and financial performance. The findings offer a comprehensive understanding of several elements of supply chain management (SSCM), including information systems, organizational configurations, supply chain network architecture (SCND), and supply chain strategy (SCS). The supply chain is essential for effectively moving goods over great distances and encouraging cooperation between parties. Therefore, these connections are established precisely, quickly, and cheaply via a knowledgeable and efficient supply chain. Two key components are necessary for a supply chain (SC) to be successful: efficient collaboration and the smooth integration of information-sharing platforms.
基金supported by the Key Fund Project for Youth Innovation of USTC(WK2040000042).
文摘Unlike the traditional decentralized channel,the drop-shipping channel entails a retailer relaying consumers’orders to the manufacturer,which proceeds to stock the orders and directly ship them to the consumers.This study explores supply chain coordination and product quality in drop-shipping and traditional channels.Specifically,we analyze the performance of both channels under wholesale price and revenue-sharing contracts.Our study yields several key findings.First,the revenue-sharing contract can coordinate both traditional and drop-shipping channels,effectively increasing supply chain performance.Second,given the channel structure,the retailer prefers the wholesale price contract,whereas the manufacturer prefers the revenue-sharing contract.Third,product quality is higher in the drop-shipping channel when demand uncertainty is high.Finally,the implementation of the revenue-sharing contract increases product quality in the traditional channel,whereas it keeps product quality unchanged in the drop-shipping channel.
基金the financial support from the National Natural Science Foundation of China(22078272&22278340)。
文摘Building well-developed ion-conductive highways is highly desirable for anion exchange membranes(AEMs).Grafting side chain is a highly effective approach for constructing a well-defined phaseseparated morphological structure and forming unblocked ion pathways in AEMs for fast ion transport.Fluorination of side chains can further enhance phase separation due to the superhydrophobic nature of fluorine groups.However,their electronic effect on the alkaline stability of side chains and membranes is rarely reported.Here,fluorine-containing and fluorine-free side chains are introduced into the polyaromatic backbone in proper configuration to investigate the impact of the fluorine terminal group on the stability of the side chains and membrane properties.The poly(binaphthyl-co-p-terphenyl piperidinium)AEM(QBNp TP)has the highest molecular weight and most dimensional stability due to its favorable backbone arrangement among ortho-and meta-terphenyl based AEMs.Importantly,by introducing both a fluorinated piperidinium side chain and a hexane chain into the p-terphenyl-based backbone,the prepared AEM(QBNp TP-QFC)presents an enhanced conductivity(150.6 m S cm^(-1))and a constrained swelling at 80℃.The electronic effect of fluorinated side chains is contemplated by experiments and simulations.The results demonstrate that the presence of strong electro-withdrawing fluorine groups weakens the electronic cloud of adjacent C atoms,increasing OH^(-)attack on the C atom and improving the stability of piperidinium cations.Hence QBNp TP-QFC possesses a robust alkaline stability at 80℃(95.3%conductivity retention after testing in 2 M Na OH for 2160 h).An excellent peak power density of 1.44 W cm^(-2)and a remarkable durability at 80℃(4.5%voltage loss after 100 h)can be observed.
基金financially supported by the National Major Project (No. 2017ZX05009-003,50)National Natural Science Foundation of China (No. 51974339+2 种基金51674270)Foreign Expert Project of the Belt and Road Innovation Talents Exchange (DL2022122001)the Research Institute of Petroleum Exploration Development of China National Petroleum Cooperation (HX20201095)。
文摘It has been demonstrated that almost all polymer-clay nanocomposites show higher temperature stability than that of pure polymer, which is attributed to the active exfoliated clay nanosheet firmly adsorbed onto the polymer chains, due to polerization and nucleation effect, the clay nanosheets could protect the polymer chains from destroying. To prove such mechanism, the water-soluble polymer nanocomposites(AAA/SLS-MMT) were synthesized by the in-situ polymerization of 2-acrylamide-2-methyl-propane sulfonic acid, acrylamide, 4-acryloylmorpholine, and organically modified montmorillonite. The techniques of nuclear magnetic resonance, atomic force microscopy and scanning electron microscopy etc., clearly characterized the successful synthesized of sample's structure, the exfoliated MMT nanosheet adsorbed polymer chain's scale, and well-dispersed morphology, espectively. The adsorption model, X-ray photoelectron spectroscopy presented the existence of strong adsorption, while molecular simulation calculations first concluded that the strong adsorption energy was-13032.06 kcal/mol. Thermo-gravimetric-analysis proved the temperature of maximum thermal degradation of powder sample(AAA/1.0 wt% SLS-MMT) was over 298℃. After ageing at 180℃ for 4 h, the apparent viscosity of 5 g/L AAA/1.0 wt% SLS-MMT aqueous solution was 326.7 mPa,s, while that of pure polymer(AAA) was only 8.3 mPa,s. This optimized sample has the smallest FLAPIvalue at all test temperatures from 180 to 220℃ in both fresh and salt water based drilling fluid. All the evidences of high temperature resistance indicate that the strong adsorption can enhance the thickness of hydrated shell and adsorption of clay particles in drilling fluid at high temperature. Such mechanism supplied the better way to design high-temperature resistant fluid loss additives for deep and ultra-deep oil and gas formation engineering.
基金supported by the National Natural Science Foundation of China(project no.42375192),and the China Meteorological Administration Climate Change Special Program(CMA-CCSPproject no.QBZ202315)+2 种基金supported by the National Natural Science Foundation of China(project no.42030608)supported by the National Research,Development and Innovation Fund,project no.OTKA-FK 142702by the Hungarian Academy of Sciences through the Sustainable Development and Technologies National Programme(FFT NP FTA)and the János Bolyai Research Scholarship.
文摘Owing to the persisting hype in pushing toward global carbon neutrality,the study scope of atmospheric science is rapidly expanding.Among numerous trending topics,energy meteorology has been attracting the most attention hitherto.One essential skill of solar energy meteorologists is solar power curve modeling,which seeks to map irradiance and auxiliary weather variables to solar power,by statistical and/or physical means.In this regard,this tutorial review aims to deliver a complete overview of those fundamental scientific and engineering principles pertaining to the solar power curve.Solar power curves can be modeled in two primary ways,one of regression and the other of model chain.Both classes of modeling approaches,alongside their hybridization and probabilistic extensions,which allow accuracy improvement and uncertainty quantification,are scrutinized and contrasted thoroughly in this review.