Identification of a novel mutation in the FGF10 gene in a Chinese family with obvious congenital lacrimal duct dysplasia in lacrimo-auriculo-dento-digital syndrome

AIM:To identify the pathogenic gene variant in a family with lacrimo-auriculo-dento-digital syndrome[LADD(MIM 149730)]showing congenital lacrimal duct dysplasia as the main clinical manifestation and lay the foundation for future research on the pathogenic gene.METHODS:Ophthalmological examinations,including slit-lamp biomicroscopy and lacrimal duct probing,and computed tomography dacryocystography(CT-DCG)were performed for all participants.The family pedigree was drawn,genetic features were analyzed,and the genomic DNA of the subjects was extracted.Pathogenic genes were screened via whole exome sequencing(WES)and confirmed using Sanger sequencing.RESULTS:Six patients belonged to this three-generation family,and their clinical manifestations included congenital nasolacrimal duct obstruction,congenital absence of lacrimal puncta and canaliculi,lacrimal fistulae,and limb deformities.This pattern indicates autosomal dominant inheritance.Diagnosis was based on the clinical characteristics of LADD syndrome,which presented in all the patients in this family.A novel frameshif t mutation in the FGF10 gene(NM_004465.1),c.234dup C(p.Trp79Leus*15),was identified in all patients via WES.The variant was confirmed by Sanger sequencing and classified as a“pathogenic mutation”according to the American College of Medical Genetics and Genomics(ACMG)variant interpretation guidelines.CONCLUSION:A novel frameshift mutation in the FGF10 gene is found in all patients.This finding helps this family with LADD syndrome receiving a more accurate clinical diagnosis and genetic counseling by extending the mutation range of the FGF10 gene.

Identification of a Novel VEGFR-3 Missense Mutation in a Chinese Family with Hereditary Lymphedema Type I

A novel mutation of vascular endothelial growth factor receptor gene （VEGFR-3）, was identified in a four-generation Chinese family with hereditary lymphedema type I （HL-I）. Genetic linkage analysis was performed on the known genetic locus for HL-I with a panel of polymorphic markers, and then mutations were screened out by direct sequencing. By genotyping, the family showed the linkage to HL-I locus on 5q35.3. Mutation screening analysis of the exons encoding the intracellular kinase domains of VEGFR-3, revealed a novel missense mutation D1055V. This mutation cosegregated with the disease phenotype in the family and was not found in 100 normal controls. This finding has expanded the spectrum of the VEGFR-3 gene mutations causing HL-I, and will be useful for further genetic consultation and genetic diagnosis.

Sequence Mutation of Exon 7 of Badh2 Gene and Aroma Identification of Fragrant Rice Varieties

In this study,we performed amplificaion and sequence analysis of exon7 of gene Badh2 of 12 fragrant rice materials,and identified the aroma of fragrant rice materials by the method of seed chewing and KOH soaking,so as to analyze the sequence mutation of exon 7 in the Badh2 gene of rice material and its corresponding relation with the flavor character.The results showed that an 8 bp deletion(aaaa--t---ggc)and a mutation of SNP(g→t)in exon 7 of Badh2 gene were found in 10 materials,including Xiangnuo,Lvjinxiang,Meixiangzhan 2,Huaxiang,Yuexiangxuan 1,Hongyuxiang,Meixiangxuan 1,Baxiangxuan 1,Taixiangxuan 1,Taixiangxuan 2.This mutation was consistent with the mutation of EU155083 sequence in GenBank and was reported for the first time in Chinese rice materials.In these 10 fragrant rice materials with mutation,Huaxiang and Meixiangxuan 1 were identified as the heterozygote genotype,and Hongyuxiang was identified as non-fragrant rice,so the sequence mutation in exon 7 of Badh2 gene in fragrant rice materials did not correspond to aroma traits one by one;and 7 materials were identified as fragrant rice,and the brown rice of Meixiangzhan 2 and Yuexiangyuan 1 had sweet taste.The results could provide a reference for the research on the genetic mechanism of rice aroma character and the promotion of fragrant rice varieties.

Identification of EGFR kinase domain mutations among lung cancer patients in China:implication for targeted cancer therapy

Lung cancer is one of the leading causes of death with one of the lowest survival rates. However, a subset of lung cancer patients who are of Asian origin and carry somatic mutations in epidermal growth factor receptor or EGFR have responded remarkable well to two tyrosine kinase inhibitors, gefitinib and erlotinib. While EGFR mutation profiles have been reported from Japan, South Korea, and Taiwan, there is no such report from mainland of China where the largest pool of patients reside. In this report, we identified ten somatic mutations from a total of 41 lung cancer patients in China. Among them, seven mutations were found in 17 adenocarcinomas. In contrast to previous reports, eight of these mutations are deletions in exon 19 and two of these deletions are homozygous. These results suggest that a large portion of Chinese adenocarcinoma patients could benefit from gefitinib or erlotinib. This unique mutation profile provides a rationale to develop the next generation of EGFR inhibitors more suitable for the Chinese population.

Identification of a novel germline missense mutation of the androgen receptor in African American men with familial prostate cancer

Race, family history and age are the unequivocally accepted risk factors for prostate cancer （PCa）. Androgen receptor （AR）-dependent signaling is an important element in prostate carcinogenesis and its progression to metastatic disease. We examined the possibility of genomic changes in the AR in association with familial PCa in African Americans who have a higher incidence and mortality rate and a clinically more aggressive disease presentation than Caucasians. Genomic DNAs of 60 patients from 30 high-risk African American and Caucasian families participating in the Louisiana State University Health Sciences Center genetic linkage study of PCa were studied. Exon-specific polymerase-chain reaction, bi-directional automated sequencing and restriction enzyme genotyping were used to analyze for mutations in the coding region of the AR gene. We identified a germline AR （A1675T） （T559S） substitution mutation in the DNA-binding domain in three PCa-affected members of an African- American family with a history of early-onset disease. The present study describes the first AR germline mutation in an African-American family with a history of familial PCa. The AR （T559S） mutation may contribute to the disease by altering AR DNA-binding affinity and/or its response to androgens, non-androgenic steroids or anti-androgens. Additional studies will be required to define the frequency and contribution of the AR （A 1675T） allele to early-onset and/or familial PCa in African Americans.

Identification of a novel p.R1443W mutation in RP1 gene associated with retinitis pigmentosa sine pigmento

AIM:To screen mutations in the retinitis pigmentosa 1(RP1) gene and the rhodopsin(RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento(RPSP)and describe the genotype-phenotype relationship of the mutations.·METHODS:Twenty affected,unrelated Chinese individuals with RPSP(4 autosomal dominant RPSP,12autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012.The clinical features were determined by complete ophthalmologic examinations.Polymerase chain reaction(PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1gene and the RHO gene.The cosegregation analysis and population frequency studies were performed for patients with identified mutations.·RESULTS:Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands.Four missense changes(rs444772,rs446227,rs414352,rs441800) and one non-coding variant(rs56340615) were common SNPs and none of them showed a significant relationship with RPSP.A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family,suggestive of pathogenic.In addition,population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls.·CONCLUSION:The identification of p.R1443W mutationcosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation,while RHO gene is not associated with the pathogenesis of RPSP in this study.To our knowledge,this is the fist mutation identified to associate with RPSP.

Identification of novel Lynch syndrome mutations in Chinese patients with endometriod endometrial cancer

Objective:Lynch syndrome(LS)predisposes patients to early onset endometrioid endometrial cancer(EEC).However,little is known about LS-related EEC in the Chinese population.The aim of this study was to investigate the prevalence of LS and to identify the specific variants of LS in Chinese patients with EEC.Methods:We applied universal immunohistochemistry screening to detect the expression of mismatch repair(MMR)proteins,which was followed by MLH1 methylation analysis to identify suspected LS cases,next-generation sequencing(NGS)to confirm LS,and microsatellite instability(MSI)analysis to verify LS.Results:We collected 211 samples with EEC.Twenty-seven(27/211,12.8%)EEC cases had a loss of MMR protein expression.After MLH1 methylation analysis,16 EEC cases were suggested to be associated with LS.Finally,through NGS and MSI analysis,we determined that 10 EEC(10/209,4.78%)cases were associated with LS.Among those cases,3 unreported mutations(1 frameshift and 2 nonsense)were identified.M SH6 c.597_597delC,found in 4 patients,is likely to be a founder mutation in China.Conclusions:We demonstrated the feasibility of a process for LS screening in Chinese patients with EEC,by using universal immunohistochemistry screening followed by MLH1 methylation analysis and confirmation through NGS and MSI analysis.The novel mutations identified in this study expand knowledge of LS.

Light-harvesting Polymer Based DNA Assay for SNP Identification of BRCA1 Mutations

We report an improved strategy for conjugated polymer-based optical DNA detection with stem-loop structured DNA probes.The high sensitivity of conjugated polymer-based biosensors arises from light harvesting by the conjugated polymer and the related amplified fluorescent signal transduction either through quenching or through Fǒrster energy transfer) In our previous publication,we demonstrated that the coupling of magnetic particles to conjugated polymers significantly improves the selectivity of this class of DNA sensors.Here we further improved the selectivity by introducing both stem-loop structured capture probe and competition probe.We demonstrated further that this improved magnetically assisted DNA sensor can conveniently identify even a single-nucleotide mismatch in the target sequence.

Pollution source identification methods and remediation technologies of groundwater: A review

Groundwater is an important source of drinking water.Groundwater pollution severely endangers drinking water safety and sustainable social development.In the case of groundwater pollution,the top priority is to identify pollution sources,and accurate information on pollution sources is the premise of efficient remediation.Then,an appropriate pollution remediation scheme should be developed according to information on pollution sources,site conditions,and economic costs.The methods for identifying pollution sources mainly include geophysical exploration,geochemistry,isotopic tracing,and numerical modeling.Among these identification methods,only the numerical modeling can recognize various information on pollution sources,while other methods can only identify a certain aspect of pollution sources.The remediation technologies of groundwater can be divided into in-situ and ex-situ remediation technologies according to the remediation location.The in-situ remediation technologies enjoy low costs and a wide remediation range,but their remediation performance is prone to be affected by environmental conditions and cause secondary pollution.The ex-situ remediation technologies boast high remediation efficiency,high processing capacity,and high treatment concentration but suffer high costs.Different methods for pollution source identification and remediation technologies are applicable to different conditions.To achieve the expected identification and remediation results,it is feasible to combine several methods and technologies according to the actual hydrogeological conditions of contaminated sites and the nature of pollutants.Additionally,detailed knowledge about the hydrogeological conditions and stratigraphic structure of the contaminated site is the basis of all work regardless of the adopted identification methods or remediation technologies.

A new era of mutation rate analyses: Concepts and methods

The mutation rate is a pivotal biological characteristic,intricately governed by natural selection and historically garnering considerable attention.Recent advances in high-throughput sequencing and analytical methodologies have profoundly transformed our understanding in this domain,ushering in an unprecedented era of mutation rate research.This paper aims to provide a comprehensive overview of the key concepts and methodologies frequently employed in the study of mutation rates.It examines various types of mutations,explores the evolutionary dynamics and associated theories,and synthesizes both classical and contemporary hypotheses.Furthermore,this review comprehensively explores recent advances in understanding germline and somatic mutations in animals and offers an overview of experimental methodologies,mutational patterns,molecular mechanisms,and driving forces influencing variations in mutation rates across species and tissues.Finally,it proposes several potential research directions and pressing questions for future investigations.

Wilson disease: Identification of two novel mutations and clinical correlation in Eastern Chinese patients

AIM: To study mutations in the P-type ATPase (ATP7B) gene responsible for Wilson disease (WD) in the Eastern Chinese population, and the possible correlation of specific mutations with clinical characteristics. METHODS: Mutations of the ATP7B gene were sought by means of direct sequencing in 50 Eastern Chinese WD patients of Han ethnic origin. RESULTS: Two novel mutations, Asp96Gly and Asp196Glu, were first identified. We also compared the characterization of mutations in ATP7B with the clinical findings, and a significant correlation with hepatic manifestations between patients carrying the Arg778Leu mutation and those without was found. CONCLUSION: Gene sequencing analysis was shown to have a high detection rate and accuracy. It may become the first priority in screening of WD patients.

Identification of speckle-type POZ protein somatic mutations in African American prostate cancer

The speckle-type POZ protein （SPOP） is a tumor suppressor in prostate cancer （PCa）. SPOP somatic mutations have been reported in up to 15% of PCa of those of European descent. However, the genetic roles of SPOP in African American （AA）-PCa are currently unknown. We sequenced the SPOP gene to identify somatic mutations in 49 AA prostate tumors and identified three missense mutations （p.Y87C, p.F102S, and p.G111E） in five AA prostate tumors （10%） and one synonymous variant （p.11061） in one tumor. Intriguingly, all of mutations and variants clustered in exon six, and all of the mutations altered conserved amino acids. Moreover, two mutations （p.F102S and p.G111E） have only been identified in AA-PCa to date. Quantitative real-time polymerase chain reaction analysis showed a lower level of SPOP expression in tumors carrying SPOP mutations than their matched normal prostate tissues. In addition, SPOP mutations and novel variants were detected in 5 of 27 aggressive PCa and one of 22 less aggressive PCa （P 〈 0.05）. Further studies with increased sample size are needed to validate the clinicopathological significance of these SPOP mutations in AA-PCa.

Identification of Known and Novel PTCH Mutations in Both Syndromic and Non-syndromic Keratocystic Odontogenic Tumors

Aim To clarify the role of PTCH in patients with NBCCS- related and non-sydromic keratocystic odontogenic tumors. Methodology Mutation analysis was undertaken in 8 sporadic and 4 NBCCS-associated KCOTs. Results Four novel and two known mutations were identifled in 2 sporadic and 3 syndromic cases, two of which being germline mutations （c.2179delT, c.2824delC） and 4 somatic mutations （c.3162dupG, c.1362-1374dup, c.1012 C〉T, c.403C〉T）. Conclusion Our findings suggest that defects of PTCH are associated with the pathogenesis of syndromic as well as a subset of non-syndromic KCOTs.

Identification of a Homozygous Missense Mutation in the TYR Gene in a Chinese Family with OCA1

Oculocutaneous albinism (OCA)is an autosomal recessive pigmentation abnormality,characterized by variable hair,skin,and ocular hypopigmentation.OCA1 is the most frequent subtype of OCA,caused by mutations in the tyrosinase gene (TYR). In this study,we investigated the genetic mutation of a Chinese family with a female OCA patient who came for genetic counseling before pregnancy.Complete physical examination was performed,and DNA from blood samples was collected from the family members.Mutations of TYR,OCA2,and SLC45A2 genes were examined in the proband, and verified in her parents by Sanger sequencing.Large deletion or duplication of TYR and OCA2 genes was detected by multiplex ligation-dependent probe amplification (MLPA).A homozygous TYR c.307T>C (p.Cys103Arg)missense mutation was identified in the proband,and both parents were heterozygous carriers.No large deletion or duplication was found in the proband.This mutation was absent in 1000G,ExAC,or HGMD database,and multiple lines of in silico tools supported a deleterious effect.These results suggest that TYR c.307T>C mutation might be responsible for OCA1,and our study further expands the mutation spectrum of OCA1 in the Chinese population.

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome

AIM:To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosisptosis-epicanthus inversus syndrome(BPES).METHODS:Thirteen patients with BPES and eight healthy family members were included in this study.All participants received routine ophthalmic examinations.The target next-generation sequencing(NGS)was performed to determine the causative mutation for this family.The silico analysis was also applied to predict the pathogenesis of identified mutations.RESULTS:All patients had severe ptosis,normal intelligence,female patients have normal fertility.Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene,c.672_701 ins GCGGCTGCCGC CGCAGCTGCTG CAGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA),carried by 13 patient but absent in all unaffected members.In silico analysis supported the pathogenic nature of this highly conserved variant.This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain,which increased the number of original polyalanine chains from 14 to 24,resulting in an extended protein.CONCLUSION:A novel FOXL2 mutation c.672_701 ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA)was identified in a large Chinese family with BPES.This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotypecorrelations,which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

Identification of a Novel COL17A1 Compound Heterozygous Mutation in a Chinese Girl with Non-Herlitz Junctional Epidermolysis Bullosa

Summary:Non-Herlitz junctional epidermolysis bullosa(JEB-nH),an autosomal recessive bullous genodermatosis,is characterized by generalized skin blistering from birth onward,dental anomalies,universal alopecia and nail dystrophy.The underlying defect is mutation of the COLI7AI gene encoding the type XVⅡcollagen,resulting in losing structure for attachment of basal epithelial cells to the matrix.In present study,we described one case of congenitally affected female child aged 10 years,with skin blistering.Dermatologic examination revealed sparse,mild blisters on the face and hand,with profound enamel pitting of the teeth.Skin biopsy from proband's bullous skin displayed subepidermal bulla formation without acantholysis.The immunofluorescence of anti-type XVⅡcollagen antibody staining showed loss of type XVⅡcollagen staining at the basement membrane zone.A combination of whole exome sequencing(WES)and Sanger sequencing revealed the novel heterozygous mutations(C.4324C>T;p.Q1442^*and C.I 834G>C;p.G612R)in COLI7AI gene,which could be associated with the observed JEB-nH.One allele had a novel nonsense mutation(c.4324C>T;p.Q1442^*),resulting in nonsense-mediated mRNA decay and truncated collagen XVⅡ;the other allelc had a novel misscnse mutation of c.1834G>C;p.G612R in exon 22,causing a glycine-to-arginine substitution in the Gly-X-Y triple helical repeating motifs and decreasing the thermal stability of collagen XVⅡ.Our findings indicate that the genetic test based on WES can be useful in diagnosing JEB-nH patients.The novel pathogenic mutations identified would further expand our understanding of the mutation spectrum of COLI7AI gene in association with the inherited blistering diseases.

Identification of Two Mutations in PCDHGA4 and SLFN14 Genes in an Atrial Septal Defect Family

Atrial septal defect (ASD)is a common acyanotic congenital cardiac disorder associated with genetic mutations.The objective of this study was to identify the genetic factors in a Chinese family with ASD patients by a whole exome sequencing approach.Causative ASD gene mutations were examined in 16 members from a three-generation family,among which 6 individuals were diagnosed as having ASD.One hundred and eighty-three unrelated healthy Chinese were recruited as a normal control group.Peripheral venous blood was collected from every subject for genetic analysis.Exome sequencing was performed in the ASD patients.Potential causal mutations were detected in non-ASD family members and normal controls by polymerase chain reaction and sequencing analysis.The results showed that all affected family members carried two novel compound mutations,c.1187delT of PCDHGA4 and c.2557insC of SLFN14,and these two mutations were considered to have synergetic function on ASD.In conclusion,the mutations of c.1187delT of PCDHGA4 and c.2557insC of SLFN14 may be pathogenic factors contributing to the development of ASD.

Fluid identification and tight oil layer classification for the southwestern Mahu Sag,Junggar Basin using NMR logging-based spectrum decomposition

The intricate distribution of oil and water in tight rocks makes pinpointing oil layers challenging.While conventional identification methods offer potential solutions,their limited accuracy precludes them from being effective in their applications to unconventional reservoirs.This study employed nuclear magnetic resonance(NMR)spectrum decomposition to dissect the NMR T_(2)spectrum into multiple subspectra.Furthermore,it employed laboratory NMR experiments to ascertain the fluid properties of these sub-spectra,aiming to enhance identification accuracy.The findings indicate that fluids of distinct properties overlap in the T_(2)spectra,with bound water,movable water,bound oil,and movable oil appearing sequentially from the low-value zone to the high-value zone.Consequently,an oil layer classification scheme was proposed,which considers the physical properties of reservoirs,oil-bearing capacity,and the characteristics of both mobility and the oil-water two-phase flow.When applied to tight oil layer identification,the scheme's outcomes align closely with actual test results.A horizontal well,deployed based on these findings,has produced high-yield industrial oil flow,underscoring the precision and dependability of this new approach.

Systematic Evaluation of Pharmacognostic Identification of Polygonum capitatum

[Objectives] To investigate the systematic evaluation of pharmacognostic identification of Polygonum capitatum . [Methods] 10 batches of P. capitatum cultivated in Guizhou were chosen for plant samples. Macroscopical identification was conducted on plant roots, stems, leaves, flowers and fruits. The P. capitatum powder was processed for physical and chemical distinction by FeCl 3 chromogenic reaction, hydrochloric acid magnesium powder reaction, AlCl 3 color development reaction and thin-layer chromatography.Microscope identification was carried out on the powder. Plant genome DNeasy Plant Kit was adopted for DNA molecular marker identification. [Results] The results showed that the stem of P. capitatum was tufted, the leaves were oval, 2 to 5 cm long, and 1 to 2 cm wide;the leaf apex was acute and cuneate at the base, the inflorescence was capitate, paired or solitary;the raceme was erect and nearly spherical, and the perianth was light red. Furthermore, for the chromogenic reaction of FeCl 3 ethanol extract of P. capitatum , appeared blue and turned to dark blue after long time storing at room temperature. For the reaction of hydrochloric acid magnesium powder, the alcohol extract of P. capitatum , exhibited deep red. In the color reaction of AlCl 3, the alcohol extract revealed yellow fluorescence under 360 nm UV lamp. Microscope identification of the powder displayed pollen grains, crystal sheath fibers, cellulose, vessels, starch grains, cork cells, and other characteristic fragments. In addition, DNA barcoding electrophoresis results showed that P. capitatum showed a clear and bright single band near 500 bp, and further sequencing results showed that the sequence differences were mainly concentrated in ITS1 and ITS2 region. [Conclusions] Systematic evaluation for the identification of P. capitatum is established, which combines with macroscopic identification, physicochemical identification, powder microscope identification, and DNA molecular identification. Finally, the original medicinal material is identified as P. capitatum Buch.-Ham. ex D. Don.

Pharmacognosy research and identification of Euphorbia prostrata Ait.

Background:Euphorbia prostrata Ait.is an annual herb widely distributed in the southern region of China with great medical values on Anti-inflammation,insect repellent,treatment of diarrhea.Despite its extensive uses as a traditional Chinese medicine,no systematic research on the identification of E.prostrata has been reported.Methods:The study aimed to establish an accurate identification system for E.prostrata through traditional pharmacognostical methods,including botanical origin,morphological characters,medicinal material characters,microscopic characters,physicochemical parameters determination,phytochemical screening,and DNA barcoding analysis.Results:Physicochemical results show that this plant likely contains flavonoids,anthraquinones,and other substances.The ITS loci of the nuclear genome and psbA-trnH loci of the chloroplast genome were selected and evaluated,which were the most variable loci.Conclusion:The findings of this study are expected to contribute to the development of species identification,as well as provide references for authenticity identification,genetic relationship analysis,and further utilization of E.prostrata.