This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
In the perifused fura-2 loaded exocrine pancreatic acinar cell line AR4-2J pulses of high potassium induced repetitive increases in intracellular calcium. Attached cells when stimulated with high potassium secreted la...In the perifused fura-2 loaded exocrine pancreatic acinar cell line AR4-2J pulses of high potassium induced repetitive increases in intracellular calcium. Attached cells when stimulated with high potassium secreted large amount of amylase. High potassium-induced secretion was dependent both on the concentration of potassium and duration of stimulation. High potassium induced increases in intracellular calcium were inhibited by voltage-dependent calcium channel antagonists with an order of potency as follows: nifedipine > ω-agatoxin IVA > ω-conotoxin GVIA. In contrast, the L-type calcium channel antagonist nifedipine almost completely inhibited potassium-induced amylase secretion, whereas the N-type channel antagonist ω-conotoxin GVIA was without effect. The P-type channel antagonist ω-agatoxin IVA had a small inhibitory effect, but this inhibition was not significant at the level of amylase secretion. In conclusion, the AR4-2J cell line possesses different voltage-dependent calcium channels (L, P,N) with the L-type predominantly involved in depolarization induced amylase secretion.展开更多
In this paper,the poly(acrylamide)hydrogel used to immobilize saccharomyces cerevisiae for asymmetric synthesis of R(-)-mandelic acid was prepared with free radical ploymerization in deionized water at room temperatur...In this paper,the poly(acrylamide)hydrogel used to immobilize saccharomyces cerevisiae for asymmetric synthesis of R(-)-mandelic acid was prepared with free radical ploymerization in deionized water at room temperature under nitrogen atmosphere.The influence of the composition of hydrogel,loading amount of cells and culture conditions on the asymmetric synthesis was investigated.Results show that PAAm hydrogel is a feasible carrier for immobilization of cells which is a potential alternative method to prepare enantiomerically pure R(-)-mandelic acid.展开更多
Asymmetric synthesis of (-)-1-trimethylsilyl-ethanol with immobilized Saccharomyces cerevisiae cells in water/organic solvent biphasic system was studied. The effects of shake speed, hydrophobicity of organic solvent,...Asymmetric synthesis of (-)-1-trimethylsilyl-ethanol with immobilized Saccharomyces cerevisiae cells in water/organic solvent biphasic system was studied. The effects of shake speed, hydrophobicity of organic solvent, volume ratio of water phase to organic phase, pH value of aqueous phase and reaction temperature on the initial reaction rate, maximum yield and enantiomeric excess (ee) of the product were systematically explored. All the above-mentioned factors had significant influence on the reaction. n-Hexane was found to be the best organic solvent for the reaction. The optimum shake speed, volume ratio of water phase to organic phase, pH value and reaction temperature were 150 r.min-1, 1/2, 8 and 30 ℃ respectively, under which the maximum yield and enantiomeric excess of the product were as high as 96.8% and 95.7%, which are 15% and 16% higher than those of the corresponding reaction performed in aqueous phase. To our best knowledge, this is the most satisfactory result obtained.展开更多
We isolated a novel laminarinase ULam111 from Flavobacterium sp. strain UMI-01. Purified ULam111 showed degradation activity against laminarin with the specific activity of 224 ± 18 U/mg at 30°C and pH 6.0. ...We isolated a novel laminarinase ULam111 from Flavobacterium sp. strain UMI-01. Purified ULam111 showed degradation activity against laminarin with the specific activity of 224 ± 18 U/mg at 30°C and pH 6.0. Its optimum temperature was 50°C, and degradation activities against laminarin were observed at 4°C - 80°C. With a laminarin degradation system, we investigated the preparation and properties of immobilized ULam111 with the use of the 11 types of carriers. The high activity recoveries of immobilized ULam111 were as follows: 19.4% for IB-S60P carrier beads (the non-ionic type), 15.6% for IB-S60S carrier beads (the non-ionic type), 11.9% for IB-150P carrier beads (the covalent type), and 7.1% for IB-C435 carrier beads (the cationic type). With the repeated use of immobilized ULam111, the enzyme activities immobilized on IB-S60S and those on IB-S60P remained at 40% and 30% respectively after the sixth trial. We selected IB-S60S as suitable beads for enzyme immobilization, and we attempted to construct a reactor system with ULam111 immobilized on IB-S60S beads. In this system, 1.2 - 1.9 g/L glucose was repeatedly produced from 30 mg/mL laminarin solutions after 20 hr when the reactor operation was repeated 10 times. We examined ethanol fermentation from the saccharified solutions with a marine-derived yeast (Saccharomyces cerevisiae C-19), and 0.51 - 0.58 g/L bioethanol was produced from the saccharified solution that contained 1.71 - 1.86 g/L of glucose.展开更多
Owing to the production of alpha, beta and gamma amylase subtypes;starch degrading microbes, especially bacteria have an invincible role in the food, fermentation, textile and paper industries. Of them, α-amylases fr...Owing to the production of alpha, beta and gamma amylase subtypes;starch degrading microbes, especially bacteria have an invincible role in the food, fermentation, textile and paper industries. Of them, α-amylases from Bacillus spp. have contributed tremendous advancements in bio-industry, especially in starch, detergent and pharmaceutical arena. Though general reviews are seen in literature on amylases, no focused review is available yet solely on α-amylases produced by Bacillus spp. Hence, this focused review on α-amylases from the genus Bacillus is designed in such a way that it should give a vivid picture on most of the aspects on bacillial α-amylases in a handy module with an industrial perspective. With a short introduction on amylases in general, α-amylases from various species of Bacillus reviewed herein encompasses production of α-amylases by submerged and solid-state fermentations;nutrients and other factors required for maximizing production;immobilization strategies for whole cells or purified enzyme;an overview on the molecular weight of the enzyme;followed by distinct sections for purification, characterisation, stability and crystal structure;and concluded with a section on industrial applications of the α-amylases from Bacillus spp.展开更多
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
文摘In the perifused fura-2 loaded exocrine pancreatic acinar cell line AR4-2J pulses of high potassium induced repetitive increases in intracellular calcium. Attached cells when stimulated with high potassium secreted large amount of amylase. High potassium-induced secretion was dependent both on the concentration of potassium and duration of stimulation. High potassium induced increases in intracellular calcium were inhibited by voltage-dependent calcium channel antagonists with an order of potency as follows: nifedipine > ω-agatoxin IVA > ω-conotoxin GVIA. In contrast, the L-type calcium channel antagonist nifedipine almost completely inhibited potassium-induced amylase secretion, whereas the N-type channel antagonist ω-conotoxin GVIA was without effect. The P-type channel antagonist ω-agatoxin IVA had a small inhibitory effect, but this inhibition was not significant at the level of amylase secretion. In conclusion, the AR4-2J cell line possesses different voltage-dependent calcium channels (L, P,N) with the L-type predominantly involved in depolarization induced amylase secretion.
文摘In this paper,the poly(acrylamide)hydrogel used to immobilize saccharomyces cerevisiae for asymmetric synthesis of R(-)-mandelic acid was prepared with free radical ploymerization in deionized water at room temperature under nitrogen atmosphere.The influence of the composition of hydrogel,loading amount of cells and culture conditions on the asymmetric synthesis was investigated.Results show that PAAm hydrogel is a feasible carrier for immobilization of cells which is a potential alternative method to prepare enantiomerically pure R(-)-mandelic acid.
基金Supported by the National Natural Science Foundation of China(No.20076019)the Natural Science Foundation of Guang-dong Province(No.000444).
文摘Asymmetric synthesis of (-)-1-trimethylsilyl-ethanol with immobilized Saccharomyces cerevisiae cells in water/organic solvent biphasic system was studied. The effects of shake speed, hydrophobicity of organic solvent, volume ratio of water phase to organic phase, pH value of aqueous phase and reaction temperature on the initial reaction rate, maximum yield and enantiomeric excess (ee) of the product were systematically explored. All the above-mentioned factors had significant influence on the reaction. n-Hexane was found to be the best organic solvent for the reaction. The optimum shake speed, volume ratio of water phase to organic phase, pH value and reaction temperature were 150 r.min-1, 1/2, 8 and 30 ℃ respectively, under which the maximum yield and enantiomeric excess of the product were as high as 96.8% and 95.7%, which are 15% and 16% higher than those of the corresponding reaction performed in aqueous phase. To our best knowledge, this is the most satisfactory result obtained.
文摘We isolated a novel laminarinase ULam111 from Flavobacterium sp. strain UMI-01. Purified ULam111 showed degradation activity against laminarin with the specific activity of 224 ± 18 U/mg at 30°C and pH 6.0. Its optimum temperature was 50°C, and degradation activities against laminarin were observed at 4°C - 80°C. With a laminarin degradation system, we investigated the preparation and properties of immobilized ULam111 with the use of the 11 types of carriers. The high activity recoveries of immobilized ULam111 were as follows: 19.4% for IB-S60P carrier beads (the non-ionic type), 15.6% for IB-S60S carrier beads (the non-ionic type), 11.9% for IB-150P carrier beads (the covalent type), and 7.1% for IB-C435 carrier beads (the cationic type). With the repeated use of immobilized ULam111, the enzyme activities immobilized on IB-S60S and those on IB-S60P remained at 40% and 30% respectively after the sixth trial. We selected IB-S60S as suitable beads for enzyme immobilization, and we attempted to construct a reactor system with ULam111 immobilized on IB-S60S beads. In this system, 1.2 - 1.9 g/L glucose was repeatedly produced from 30 mg/mL laminarin solutions after 20 hr when the reactor operation was repeated 10 times. We examined ethanol fermentation from the saccharified solutions with a marine-derived yeast (Saccharomyces cerevisiae C-19), and 0.51 - 0.58 g/L bioethanol was produced from the saccharified solution that contained 1.71 - 1.86 g/L of glucose.
文摘Owing to the production of alpha, beta and gamma amylase subtypes;starch degrading microbes, especially bacteria have an invincible role in the food, fermentation, textile and paper industries. Of them, α-amylases from Bacillus spp. have contributed tremendous advancements in bio-industry, especially in starch, detergent and pharmaceutical arena. Though general reviews are seen in literature on amylases, no focused review is available yet solely on α-amylases produced by Bacillus spp. Hence, this focused review on α-amylases from the genus Bacillus is designed in such a way that it should give a vivid picture on most of the aspects on bacillial α-amylases in a handy module with an industrial perspective. With a short introduction on amylases in general, α-amylases from various species of Bacillus reviewed herein encompasses production of α-amylases by submerged and solid-state fermentations;nutrients and other factors required for maximizing production;immobilization strategies for whole cells or purified enzyme;an overview on the molecular weight of the enzyme;followed by distinct sections for purification, characterisation, stability and crystal structure;and concluded with a section on industrial applications of the α-amylases from Bacillus spp.
