APPLICATION OF FULLERENES TO THE STUDY ON ITIES Ⅰ:INHIBITION TO THE TRANSFER OF TMA^+

For the first time,fullerenes are applied to the study on the interface between two immisible electrolyte solutions.Experiments show they are a new kind of inhibitors. Obvious inhibitive behavior to the TMA^+ transfer across the water/nitrobenzene interface is observed.

Building the Pharmacophore Model of HIV-1 Integrase Strand Transfer Inhibitors and Studying Their Inhibition Mechanism

The replication of HIV-1 requires the integration of its cyclic DNA into host DNA by HIV-1 integrase （IN）, which includes two important reactions, 3＇-processing and strand transfer, both catalyzed by HIV-1 IN. Disrupting either of the reactions will fulfill the purpose of inhibiting the replication of HIV-1. In this paper, pharmacophore modeling and molecular docking are employed to investigate the inhibition mechanism of the HIV-1 IN strand transfer inhibitors （INSTIs）. Based on the results, we suggest that the inhibition mechanism of INSTIs involves the inhibitor chelating the cofactors Mg2＋ and its forming hydrogen bonds with some crucial residues adjacent to the DDE active center.

Embryo Transfer Strategies for Women with Recurrent Implantation Failure During the Frozen-thawed Embryo Transfer Cycles:Sequential Embryo Transfer or Double-blastocyst Transfer?

Objective Both sequential embryo transfer(SeET)and double-blastocyst transfer(DBT)can serve as embryo transfer strategies for women with recurrent implantation failure(RIF).This study aims to compare the effects of SeET and DBT on pregnancy outcomes.Methods Totally,261 frozen-thawed embryo transfer cycles of 243 RIF women were included in this multicenter retrospective analysis.According to different embryo quality and transfer strategies,they were divided into four groups:group A,good-quality SeET(GQ-SeET,n=38 cycles);group B,poor-quality or mixed-quality SeET(PQ/MQ-SeET,n=31 cycles);group C,good-quality DBT(GQ-DBT,n=121 cycles);and group D,poor-quality or mixed-quality DBT(PQ/MQ-DBT,n=71 cycles).The main outcome,clinical pregnancy rate,was compared,and the generalized estimating equation(GEE)model was used to correct potential confounders that might impact pregnancy outcomes.Results GQ-DBT achieved a significantly higher clinical pregnancy rate(aOR 2.588,95%CI 1.267–5.284,P=0.009)and live birth rate(aOR 3.082,95%CI 1.482–6.412,P=0.003)than PQ/MQ-DBT.Similarly,the clinical pregnancy rate was significantly higher in GQ-SeET than in PQ/MQ-SeET(aOR 4.047,95%CI 1.218–13.450,P=0.023).The pregnancy outcomes of GQ-SeET were not significantly different from those of GQ-DBT,and the same results were found between PQ/MQ-SeET and PQ/MQ-DBT.Conclusion SeET relative to DBT did not seem to improve pregnancy outcomes for RIF patients if the embryo quality was comparable between the two groups.Better clinical pregnancy outcomes could be obtained by transferring good-quality embryos,no matter whether in SeET or DBT.Embryo quality plays a more important role in pregnancy outcomes for RIF patients.

Tunneling Electrons Triggered Energy Transfer between Coherently Coupled Donor-Acceptor Molecules

Energy transfer is ubiquitous in natural and artificial lightharvesting systems,and coherent energy transfer,a highly efficient energy transfer process,has been accepted to play a vital role in such systems.However,the energy oscillation of coherent energy transfer is exceedingly difficult to capture because of its evanescence due to the interaction with a thermal environment.Here a microscopic quantum model is used to study the time evolution of electrons triggered energy transfer between coherently coupled donoracceptor molecules in scanning tunneling microscope(STM).A series of topics in the plasmonic nanocavity(PNC)coupled donor-acceptor molecules system are discussed,including resonant and nonresonant coherent energy transfer,dephasing assisted energy transfer,PNC coupling strength dependent energy transfer,Fano resonance of coherently coupled donor-acceptor molecules,and polariton-mediated energy transfer.

Inhibition expression of multidrug resistant in tumor cell by MDR1 antisense RNA gene transfer as a way of increasing toxicity of chemotherapy

A plasmid expressing antisense MDRl cDNAsegment was introduced into KBv200 which inductedmultiple drugs to VCT （vincristine, 175 fold-resistancehigher than that in original KB cells） and ADM（adriamycin, 14. 5 fold） resulting over-expression ofMDRl. We used the primers for antisense RNA asfollowing: upstream 5′OGAATTCTGAAACCTGTAAGCAGCAACC 3′: downstream

Performance Analysis and Optimization of Energy Harvesting Modulation for Multi-User Integrated Data and Energy Transfer

Integrated data and energy transfer(IDET)enables the electromagnetic waves to transmit wireless energy at the same time of data delivery for lowpower devices.In this paper,an energy harvesting modulation(EHM)assisted multi-user IDET system is studied,where all the received signals at the users are exploited for energy harvesting without the degradation of wireless data transfer(WDT)performance.The joint IDET performance is then analysed theoretically by conceiving a practical time-dependent wireless channel.With the aid of the AO based algorithm,the average effective data rate among users are maximized by ensuring the BER and the wireless energy transfer(WET)performance.Simulation results validate and evaluate the IDET performance of the EHM assisted system,which also demonstrates that the optimal number of user clusters and IDET time slots should be allocated,in order to improve the WET and WDT performance.

Inhibition of long non-coding RNA TUG1 on gastric cancer cell transference and invasion through regulating and controlling the expression of miR-144/c-Met axis

Objective: To discuss the expression of long noncoding RNA TUG1 (IneRNA-TUG1) in gastric carcinoma (GC) and its effects on the transferring and invading capacity of gastric carcinoma cells. Methods: Forty cases of carcinoma tissue and para-carcinoma tissue were selected from GC patients who underwent surgical removal in Zhejiang Provincial Hospital of Chinese Traditional Medicine and Wenzhou Central Hospital from January, 2013 to December, 2014; the expressing level of IncRNA-TUG I in GC and para-C tissues was detected by applying the qRT-PCR technique. The correlation between IncRNA-TUG1 expression and patients' clinical data was classified and analyzed. SGC-7901 cells were transfected using IncRNA-TUG1 specific siRNA. Changes of the transferring and invading capacity of siRNA-transfected SGC-7901 cells were scratch-tested and transwell-detected. qRT-PCR was applied to detect the expression level of microRNA-144 after IncRNA-TUG1 was silenced. Changes of c-Met mRNA and protein expressions was detected by qRT-PCR and western -blot test. Results: The expression level of lneRNA-TUG1 in GC tissue was significant higher than that in para-C tissue (P<0.05) and the high expression level of IncRNA-TUG1 in GC tissue was significantly correlated with tumor lymph nodes metastasis and advance TNM phasing (/'<0.05). The transferring and invading capacity of SGC-7901 cells was highly inhibited after being transfected by IncRNA-TUG1 specific siRNA (P<0.05). The results of qRT-PCR and western -blot proved that the expression of microRNA-144 was significantly boosted and the expression level of c-Met mRNA and protein was inhibited after IncRNA-TUG1 was silenced (P<0.05). Conclusions: IncRNA-TUG1 shows an up -regulated expression in GC tissue and that bears a correlation with clinicopathological features of malignant tumor. IncRNATUGI can promote the transferring and invading capacity of GC by inhibiting the pathway of microRNA-144/c-Met.

Presentation and management outcome of foot drop with tibialis posterior tendon transfer

BACKGROUND Foot drop causes considerable disability.The ankle-dorsiflexion is either weak or lost completely.Additionally,the ankle eversion and toe extensions are also impaired.This results in a high steppage gait while walking.Overall,the gait is awkward;there is greater energy consumption;increased proneness to sustain injury of the forefoot;and more frequent falling during walking.AIM To document the clinical and epidemiological profile of foot drop patients in our population and evaluate the outcome of tibialis posterior(TP)tendon transfer for restoring the lost dorsiflexion in foot drop.METHODS The study was carried out at the National Institute of Rehabilitation Medicine in Islamabad over a period of 7 years.It included patients of all sexes and ages who presented with foot drop and had no contraindications for the procedure of TP tendon transfer.Exclusion criteria were patients who had contraindications for the operation.For instance,paralyzed posterior leg compartment muscles,Achilles tendon contracture,stiff ankle or toes,unstable ankle joint,weak gastrocnemius and scarred skin spanning over the route of planned tendon transfer.Also,patients who had the foot drop as a result of disc prolapses or brain diseases were excluded.Convenience sampling technique was used.The circum-tibial route of TP tendon transfer was employed.RESULTS Out of 37 patients,26(70.27%)were males whereas 11(29.72%)were females.The mean age was 22.59±8.19 years.Among the underlying causes of foot drop,road traffic accidents constituted the most common cause,found among 20(54.05%)patients.The share of complications included wound infections in 3(8.10%)patients and hypertrophic scars in 2(5.40%)patients.At 1-year postoperative follow-up visits,the outcome was excellent in 8(21.62%),good in 20(54.05%)and moderate in 9(24.31%).CONCLUSION The majority of cases of foot drop resulted from road traffic accidents that directly involved the common peroneal nerve.TP tendon transfer through the circumtibial route was found to be an easily executed effective operation which restored good dorsiflexion of the ankle among the majority of patients.

Sensitivity of Commercial Enzyme Inhibition Colorimetric Pesticide Residue Rapid Test Kit to a Variety of Pesticides

[Objectives]To fully understand the quality of commercial enzyme inhibition-colorimetric pesticide residue rapid detection kits,so that they can play a greater role in the detection and supervision of agricultural products.[Methods]The sensitivity of 28 kinds of pesticides was determined by using the commercially available enzyme inhibition colorimetric rapid detection kit with Hendu brand.[Results]There was a significant difference in the sensitivity of the kit to each pesticide,and the kit was more sensitive to dichlorvos among the 28 pesticides tested.The sensitivity to methyl isosalifos,dimethoate,isocarbophos,fenthion and phorate was poor,and the sensitivity to quinalphos was different between 3.0 and 2.5 mL.[Conclusions]The large difference of the sensitivity of the enzyme inhibition-colorimetric rapid detection kit for pesticide residues to different kits is a reason for the false positive and false negative test results of the kit,which needs to be considered by relevant personnel.

Improving Heat Transfer in Parabolic Trough Solar Collectors by Magnetic Nanofluids

A parabolic trough solar collector(PTSC)converts solar radiation into thermal energy.However,low thermal efficiency of PTSC poses a hindrance to the deployment of solar thermal power plants.Thermal performance of PTSC is enhanced in this study by incorporating magnetic nanoparticles into the working fluid.The circular receiver pipe,with dimensions of 66 mm diameter,2 mm thickness,and 24 m length,is exposed to uniform temperature and velocity conditions.The working fluid,Therminol-66,is supplemented with Fe3O4 magnetic nanoparticles at concentrations ranging from 1%to 4%.The findings demonstrate that the inclusion of nanoparticles increases the convective heat transfer coefficient(HTC)of the PTSC,with higher nanoparticle volume fractions leading to greater heat transfer but increased pressure drop.The thermal enhancement factor(TEF)of the PTSC is positively affected by the volume fraction of nanoparticles,both with and without a magnetic field.Notably,the scenario with a 4%nanoparticle volume fraction and a magnetic field strength of 250 G exhibits the highest TEF,indicating superior thermal performance.These findings offer potential avenues for improving the efficiency of PTSCs in solar thermal plants by introducing magnetic nanoparticles into the working fluid.

Efficient Gene Transfer Mediated by HIV-1-based Defective Lentivector and Inhibition of HIV-1 Replication

Lentiviral vectors have drawn considerable attention recently and show great promise to become important delivery vehicles for future gene transfer manipulation. In the present study we have optimized a protocol for preparation of human immunodeficiency virus type-1 (HIV-1)-based defective lentiviral vectors (DLV) and characterized these vectors in terms of their transduction of different cells. Transient co-transfection of 293T packaging cells with DNA plasmids encoding lentiviral vector constituents resulted in production of high-titer DLV (0.5-1.2 × 107IU/mL), which can be further concentrated over 100-fold through a single step ultracentrifugation. These vectors were capable of transducing a variety of cells from both primate and non-primate sources and high transduction efficiency was achieved using concentrated vectors. Assessment of potential generation of RCV revealed no detection of infection by infectious particles in DLV-transduced CEM, SupT-1 and MT-2 cells. Long-term culture of transduced cells showed a stable expression of transgenes without apparent alteration in cellular morphology and growth kinetics. Vector mobilization to untransduced cells mediated by wild-type HIV-1 infection was confirmed in this test. Challenge of transduced human T-lymphocytes with wild-type HIV-1 showed these cells are totally resistant to the viral infection. Considering the effective gene transfer and stable gene expression, safety and anti-HIV activity, these DLV vectors warrant further exploration for their potential use as a gene transfer vehicle in the development of gene therapy protocols.

Heterointerface Engineering-Induced Oxygen Defects for the Manganese Dissolution Inhibition in Aqueous Zinc Ion Batteries

Manganese-based material is a prospective cathode material for aqueous zinc ion batteries(ZIBs)by virtue of its high theoretical capacity,high operating voltage,and low price.However,the manganese dissolution during the electrochemical reaction causes its electrochemical cycling stability to be undesirable.In this work,heterointerface engineering-induced oxygen defects are introduced into heterostructure MnO_(2)(δa-MnO_(2))by in situ electrochemical activation to inhibit manganese dissolution for aqueous zinc ion batteries.Meanwhile,the heterointerface between the disordered amorphous and the crystalline MnO_(2)ofδa-MnO_(2)is decisive for the formation of oxygen defects.And the experimental results indicate that the manganese dissolution ofδa-MnO_(2)is considerably inhibited during the charge/discharge cycle.Theoretical analysis indicates that the oxygen defect regulates the electronic and band structure and the Mn-O bonding state of the electrode material,thereby promoting electron transport kinetics as well as inhibiting Mn dissolution.Consequently,the capacity ofδa-MnO_(2)does not degrade after 100 cycles at a current density of 0.5 Ag^(-1)and also 91%capacity retention after 500cycles at 1 Ag^(-1).This study provides a promising insight into the development of high-performance manganese-based cathode materials through a facile and low-cost strategy.

Inhibition of protein degradation increases the Bt protein concentration in Bt cotton

Bacillus thuringiensis(Bt)cotton production is challenged by two main problems,i.e.,the low concentration of Bt protein at the boll setting stage and the lowest insect resistance in bolls among all the cotton plant’s organs.Therefore,increasing the Bt protein concentration at the boll stage,especially in bolls,has become the main goal for increasing insect resistance in cotton.In this study,two protein degradation inhibitors(ethylene diamine tetra acetic acid(EDTA)and leupeptin)were sprayed on the bolls,subtending leaves,and whole cotton plants at the peak flowering stage of two Bt cultivars(medium maturation Sikang 1(SK1))and early maturation Zhongmian 425(ZM425)in 2019 and 2020.The Bt protein content and protein degradation metabolism were assessed.The results showed that the Bt protein concentrations were enhanced by 21.3 to 38.8%and 25.0 to 38.6%in the treated bolls of SK1 and ZM425 respectively,while they were decreased in the subtending leaves of these treated bolls.In the treated leaves,the Bt protein concentrations increased by 7.6 to 23.5%and 11.2 to 14.9%in SK1 and ZM425,respectively.The combined application of EDTA and leupeptin to the whole cotton plant increased the Bt protein concentrations in both bolls and subtending leaves.The Bt protein concentrations in bolls were higher,increasing by 22.5 to 31.0%and 19.6 to 32.5%for SK1 and ZM425,respectively.The organs treated with EDTA or/and leupeptin showed reduced free amino acid contents,protease and peptidase activities and significant enhancements in soluble protein contents.These results indicated that inhibiting protein degradation could improve the protein content,thus increasing the Bt protein concentrations in the bolls or/and leaves of cotton plants.Therefore,the increase in the Bt protein concentration without yield reduction suggested that these two protein degradation inhibitors may be applicable for improving insect resistance in cotton production.

Causal Analysis Between Rice Growth and Cadmium Accumulation and Transfer under Arbuscular Mycorrhizal Inoculation

Cadmium(Cd)contamination in rice has been a serious threat to human health.To investigate the effects of arbuscular mycorrhizal fungi(AMF)on the Cd translocation in rice,a controlled pot experiment was conducted.The results indicated that AMF significantly increased rice biomass,with an increase of up to 40.0%,particularly in root biomass by up to 68.4%.Notably,the number of prominent rice individuals also increased,and their plasticity was enhanced following AMF inoculation.AMF led to an increase in the net photosynthetic rate and antioxidant enzyme activity of rice.In the AMF treatment group,the Cd concentration in the rice roots was significantly higher(19.1%‒68.0%)compared with that in the control group.Conversely,the Cd concentration in the rice seeds was lower in the AMF treatment group,indicating that AMF facilitated the sequestration of Cd in rice roots and reduced Cd accumulation in the seeds.Path coefficients varied across different treatments,suggesting that AMF inoculation reduced the direct impact of soil Cd concentration on the total Cd accumulation in seeds.The translocation of Cd was consistently associated with simultaneous growth dilution and compensatory accumulation as a result of mycorrhizal effects.Our study quantitatively analyzed this process through path analysis and clarified the causal relationship between rice growth and Cd transfer under the influence of AMF.

Robust Information Hiding Based on Neural Style Transfer with Artificial Intelligence

This paper proposes an artificial intelligence-based robust information hiding algorithm to address the issue of confidential information being susceptible to noise attacks during transmission.The algorithm we designed aims to mitigate the impact of various noise attacks on the integrity of secret information during transmission.The method we propose involves encoding secret images into stylized encrypted images and applies adversarial transfer to both the style and content features of the original and embedded data.This process effectively enhances the concealment and imperceptibility of confidential information,thereby improving the security of such information during transmission and reducing security risks.Furthermore,we have designed a specialized attack layer to simulate real-world attacks and common noise scenarios encountered in practical environments.Through adversarial training,the algorithm is strengthened to enhance its resilience against attacks and overall robustness,ensuring better protection against potential threats.Experimental results demonstrate that our proposed algorithm successfully enhances the concealment and unknowability of secret information while maintaining embedding capacity.Additionally,it ensures the quality and fidelity of the stego image.The method we propose not only improves the security and robustness of information hiding technology but also holds practical application value in protecting sensitive data and ensuring the invisibility of confidential information.

Generation of mitochondrial replacement monkeys by female pronucleus transfer

Mutations in mitochondrial DNA(mtDNA)are maternally inherited and have the potential to cause severe disorders.Mitochondrial replacement therapies,including spindle,polar body,and pronuclear transfers,are promising strategies for preventing the hereditary transmission of mtDNA diseases.While pronuclear transfer has been used to generate mitochondrial replacement mouse models and human embryos,its application in non-human primates has not been previously reported.In this study,we successfully generated four healthy cynomolgus monkeys(Macaca fascicularis)via female pronuclear transfer.These individuals all survived for more than two years and exhibited minimal mtDNA carryover(3.8%–6.7%),as well as relatively stable mtDNA heteroplasmy dynamics during development.The successful establishment of this nonhuman primate model highlights the considerable potential of pronuclear transfer in reducing the risk of inherited mtDNA diseases and provides a valuable preclinical research model for advancing mitochondrial replacement therapies in humans.

Effects of projectile parameters on the momentum transfer and projectile melting during hypervelocity impact

The effects of projectile/target impedance matching and projectile shape on energy,momentum transfer and projectile melting during collisions are investigated by numerical simulation.By comparing the computation results with the experimental results,the correctness of the calculation and the statistical method of momentum transfer coefficient is verified.Different shapes of aluminum,copper and heavy tungsten alloy projectiles striking aluminum,basalt,and pumice target for impacts up to 10 km/s are simulated.The influence mechanism of the shape of the projectile and projectile/target density on the momentum transfer was obtained.With an increase in projectile density and length-diameter ratio,the energy transfer time between the projectile and targets is prolonged.The projectile decelerates slowly,resulting in a larger cratering depth.The energy consumed by the projectile in the excavation stage increased,resulting in lower mass-velocity of ejecta and momentum transfer coefficient.The numerical simulation results demonstrated that for different projectile/target combinations,the higher the wave impedance of the projectile,the higher the initial phase transition velocity and the smaller the mass of phase transition.The results can provide theoretical guidance for kinetic impactor design and material selection.

Coherent optical frequency transfer via 972-km fiber link

We demonstrate coherent optical frequency dissemination over a distance of 972 km by cascading two spans where the phase noise is passively compensated for.Instead of employing a phase discriminator and a phase locking loop in the conventional active phase control scheme,the passive phase noise cancellation is realized by feeding double-trip beat-note frequency to the driver of the acoustic optical modulator at the local site.This passive scheme exhibits fine robustness and reliability,making it suitable for long-distance and noisy fiber links.An optical regeneration station is used in the link for signal amplification and cascaded transmission.The phase noise cancellation and transfer instability of the 972-km link is investigated,and transfer instability of 1.1×10^(-19)at 10^(4)s is achieved.This work provides a promising method for realizing optical frequency distribution over thousands of kilometers by using fiber links.

Alleviated photoinhibition on nitrification in the Indian Sector of the Southern Ocean

Nitrification,a central process in the marine nitrogen cycle,produces regenerated nitrate in the euphotic zone and emits N_(2)O,a potent greenhouse gas as a by-product.The regulatory mechanisms of nitrification in the Southern Ocean,which is a critical region for CO_(2)sequestration and radiative benefits,remain poorly understood.Here,we investigated the in situ and dark nitrification rates in the upper 500 m and conducted substrate kinetics experiments across the Indian Sector in the Cosmonaut and Cooperation seas in the late austral summer.Our findings indicate that light inhibition of nitrification decreases exponentially with depth,exhibiting a light threshold of 0.53%photosynthetically active radiation.A positive relationship between dark nitrification and apparent oxygen utilization suggests a dependence on substrate availability from primary production.Importantly,an increased NH_(4)^(+) supply can act as a buffer against photo-inhibitory damage.Globally,substrate affinity(α)increases with depth and transitions from light to dark,decreases with increasing ambient NH_(4)^(+)and exhibits a latitudinal distribution,reflecting substrate utilization strategies.We also reveal that upwelling in Circumpolar Deep Water(CDW)stimulates nitrification through the introduction of potentially higher iron and deep diverse nitrifying microorganisms with higherα.We conclude that although light is the primary limiting factor for nitrification in summer,coupling between substrate availability and CDW upwelling can overcome this limitation,thereby alleviating photoinhibition by up to 45%±5.3%.

Label Recovery and Trajectory Designable Network for Transfer Fault Diagnosis of Machines With Incorrect Annotation

The success of deep transfer learning in fault diagnosis is attributed to the collection of high-quality labeled data from the source domain.However,in engineering scenarios,achieving such high-quality label annotation is difficult and expensive.The incorrect label annotation produces two negative effects:1)the complex decision boundary of diagnosis models lowers the generalization performance on the target domain,and2)the distribution of target domain samples becomes misaligned with the false-labeled samples.To overcome these negative effects,this article proposes a solution called the label recovery and trajectory designable network(LRTDN).LRTDN consists of three parts.First,a residual network with dual classifiers is to learn features from cross-domain samples.Second,an annotation check module is constructed to generate a label anomaly indicator that could modify the abnormal labels of false-labeled samples in the source domain.With the training of relabeled samples,the complexity of diagnosis model is reduced via semi-supervised learning.Third,the adaptation trajectories are designed for sample distributions across domains.This ensures that the target domain samples are only adapted with the pure-labeled samples.The LRTDN is verified by two case studies,in which the diagnosis knowledge of bearings is transferred across different working conditions as well as different yet related machines.The results show that LRTDN offers a high diagnosis accuracy even in the presence of incorrect annotation.