Polamines are the major seed storage proteinsin most of the sereals. The rice prolaminescontain a high mole percentage of glutamineresidues and low levels of lysine, histidine,cystine, and methionine. Among the fourco...Polamines are the major seed storage proteinsin most of the sereals. The rice prolaminescontain a high mole percentage of glutamineresidues and low levels of lysine, histidine,cystine, and methionine. Among the fourcomponent of rice prolamines, 16KDa and10KDa contain more sulfate-riched amino acidresidues. So the total prolamine content andthe percentages of each component were im-portant to parameters for the rice storage pro-tein and its nutrient value. Prolamines of 36rice lines were studied with SDS-PAGE, andrelative quantities of 16 KDa, 13 a, 13 b, and展开更多
Arid and semi-arid regions of China account for more than half of the country. Because of drought resistance and high nutritive value, elite foxtail millet (Setaria Italica (L.) P. Beauv.) is one of the most important...Arid and semi-arid regions of China account for more than half of the country. Because of drought resistance and high nutritive value, elite foxtail millet (Setaria Italica (L.) P. Beauv.) is one of the most important cereal crops in China. Evaluation of germplasm and genetic diversity of foxtail millet is still in its infancy, but prolamin could play an important role as a protein marker. To investigate the genetic diversity and population structure of foxtail millet from different ecological zones of China, 90 accessions of foxtail millet were collected from three major ecological areas: North, Northwest, and Northeast China. The prolamin contents were examined by acid polyacrylamide gel electrophoresis (acid-PAGE). Five to twenty-two prolamin bands appeared in tested varieties, of which were polymorphic, so prolamin patterns of foxtail millet varieties can be used in variety identification and evaluation. Structure analysis identified six groups, which matches their pedigree information but not their geographic origins. This indicated a high degree (87.78%) of consistency with a phylogenetic classification based on SSR. The results showed prolamin banding patterns were an effective method for analyzing foxtail millet genetic variability.展开更多
Most of the work on rice storage proteins focused on the major fraction - glutelin. In contrast to previous reports of the occurrence of single legumin-like polypeptide pair in glutelin, two-dimensional gel electropho...Most of the work on rice storage proteins focused on the major fraction - glutelin. In contrast to previous reports of the occurrence of single legumin-like polypeptide pair in glutelin, two-dimensional gel electrophoresis revealed many glutelin bands, with some having and some lacking disulphide-linkages. Five legumin-like polypeptide pairs exhibited wide heterogeneity over a range of molecular weight （Mr） 25 to 60 kDa, each having a large subunit （Mr ranged from 18 to 40.5 kDa） disulphide-bonded to a small subunit （Mr ranged from 16.5 to 18.0 kDa）. A band of 49 kDa was homodimeric with two subunits of 29 kDa each; a polypeptide of 51 kDa which altered position to ones corresponding to 53 kDa and 57 kDa on 2-D gels contained intrapolypeptide linkages. Polypeptides of 65 kDa and 60 kDa occurred as aggregates of 110 kDa. The number of polypeptides in other seed protein fractions albumins, globulins and prolamins, varied from four to ten. One of the albumin bands had intrapolypeptide disulphide linkages （20 kDa） and the globulins contained two such bands （13.5 and 20 kDa）. Thus, the present study provides a description of the polypeptide composition of different rice protein fractions that is finely resolved with respect to the occurrence of disulphide linkages.展开更多
Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far...Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far, several sufur-rich seed protein genes have been isolated and the essential amino acid contents of seed proteins were increased in transgenic tobacco and Brassica napus. In this paper we report the isolation and sequencing of the 10kd prolamin gene from seeds. Poly(A) RNA were prepared from the immature endosperms of japonica rice, Sachiminori, 10 d after flowering. Complementary DNAs were synthesized according to Promega Instruction Manual. Two primers were synthesized and their sequences were Primer Ⅰ: CGTCTACACCATCTGGAATC, Primer Ⅱ: GTGTTTGCAGATAGTATGC. The amplified fragraents were inserted into the Sma I site of pGEM-7zf(+) and was used to transform E. coli JM101 after PCR reaction. DNA sequence were determined by Sanger’s Chain-termination method. Synthesis of cDNA. Using mRNAs as展开更多
Rice(Oryza sativa L.)is the most important food crop for at least half of the world’s population.Due to improved living standards,the cultivation of high-quality rice for different purposes and markets has become a m...Rice(Oryza sativa L.)is the most important food crop for at least half of the world’s population.Due to improved living standards,the cultivation of high-quality rice for different purposes and markets has become a major goal.Rice quality is determined by the presence of many nutritional components,including seed storage proteins(SSPs),which are the second most abundant nutrient components of rice grains after starch.Rice SSP biosynthesis requires the participation of multiple organelles and is influenced by the external environment,making it challenging to understand the molecular details of SSP biosynthesis and improve rice protein quality.In this review,we highlight the current knowledge of rice SSP biosynthesis,including a detailed description of the key molecules involved in rice SSP biosynthetic processes and the major environmental factors affecting SSP biosynthesis.The effects of these factors on SSP accumulation and their contribution to rice quality are also discussed based on recent findings.This recent knowledge suggests not only new research directions for exploring rice SSP biosynthesis but also innovative strategies for breeding high-quality rice varieties.展开更多
The 5’ upstream region (—680—+40) containing the complete signal peptide coding sequence of the rice seed storage prolamin gene was amplified in vitro with polymerase chain reaction from the genome of Chinese super...The 5’ upstream region (—680—+40) containing the complete signal peptide coding sequence of the rice seed storage prolamin gene was amplified in vitro with polymerase chain reaction from the genome of Chinese super rice cultivar Zhonghua 8. Physical map and DNA sequence analysis showed strong homology with the 5’-flanking region of rice prolamin gene reported by Kim in 1988. No changes in the signal peptide coding sequence and a long leader sequence with several small ORFs were found. Chimeric gene containing 5’-flanking region of the prolamin gene has been transcriptionally fused with the β-glucuronidase reporter gene. The fusion junction was confirmed by both physical map and DNA sequence analysis. The resultant chimeric gene was used to transform the tabacco explants by Ti binary system of Agrobacterium tumefaciens LBA4404. With dot and Southern blotting hybridization, three transgenic tobacco plants with the copies of chimeric GUS genes as many as 20 were obtained. Histochemical analysis展开更多
A central role of the endoplasmic reticulum(ER)is the synthesis,folding and quality control of secretory proteins.Secretory proteins usually exit the ER to enter the Golgi apparatus in coat protein complex II(COPII)-c...A central role of the endoplasmic reticulum(ER)is the synthesis,folding and quality control of secretory proteins.Secretory proteins usually exit the ER to enter the Golgi apparatus in coat protein complex II(COPII)-coated vesicles before transport to different subcellular destinations.However,in plants there are specialized ER-derived vesicles(ERDVs)that carry specific proteins but,unlike COPII vesicles,can exist as independent organelles or travel to the vacuole in a Golgi-independent manner.These specialized ERDVs include protein bodies and precursor-accumulating vesicles that accumulate storage proteins in the endosperm during seed development.Specialized ERDVs also include precursor protease vesicles that accumulate amino acid sequence KDEL-tailed cysteine proteases and ER bodies in Brassicales plants that accumulate myrosinases that hydrolyzes glucosinolates.These functionally specialized ERDVs act not only as storage organelles but also as platforms for signal-triggered processing,activation and deployment of specific proteins with important roles in plant growth,development and adaptive responses.Some specialized ERDVs have also been exploited to increase production of recombinant proteins and metabolites.Here we discuss our current understanding of the functional diversity,evolutionary mechanisms and biotechnological application of specialized ERDVs,which are associated with some of the highly remarkable characteristics important to plants.展开更多
文摘Polamines are the major seed storage proteinsin most of the sereals. The rice prolaminescontain a high mole percentage of glutamineresidues and low levels of lysine, histidine,cystine, and methionine. Among the fourcomponent of rice prolamines, 16KDa and10KDa contain more sulfate-riched amino acidresidues. So the total prolamine content andthe percentages of each component were im-portant to parameters for the rice storage pro-tein and its nutrient value. Prolamines of 36rice lines were studied with SDS-PAGE, andrelative quantities of 16 KDa, 13 a, 13 b, and
文摘Arid and semi-arid regions of China account for more than half of the country. Because of drought resistance and high nutritive value, elite foxtail millet (Setaria Italica (L.) P. Beauv.) is one of the most important cereal crops in China. Evaluation of germplasm and genetic diversity of foxtail millet is still in its infancy, but prolamin could play an important role as a protein marker. To investigate the genetic diversity and population structure of foxtail millet from different ecological zones of China, 90 accessions of foxtail millet were collected from three major ecological areas: North, Northwest, and Northeast China. The prolamin contents were examined by acid polyacrylamide gel electrophoresis (acid-PAGE). Five to twenty-two prolamin bands appeared in tested varieties, of which were polymorphic, so prolamin patterns of foxtail millet varieties can be used in variety identification and evaluation. Structure analysis identified six groups, which matches their pedigree information but not their geographic origins. This indicated a high degree (87.78%) of consistency with a phylogenetic classification based on SSR. The results showed prolamin banding patterns were an effective method for analyzing foxtail millet genetic variability.
文摘Most of the work on rice storage proteins focused on the major fraction - glutelin. In contrast to previous reports of the occurrence of single legumin-like polypeptide pair in glutelin, two-dimensional gel electrophoresis revealed many glutelin bands, with some having and some lacking disulphide-linkages. Five legumin-like polypeptide pairs exhibited wide heterogeneity over a range of molecular weight （Mr） 25 to 60 kDa, each having a large subunit （Mr ranged from 18 to 40.5 kDa） disulphide-bonded to a small subunit （Mr ranged from 16.5 to 18.0 kDa）. A band of 49 kDa was homodimeric with two subunits of 29 kDa each; a polypeptide of 51 kDa which altered position to ones corresponding to 53 kDa and 57 kDa on 2-D gels contained intrapolypeptide linkages. Polypeptides of 65 kDa and 60 kDa occurred as aggregates of 110 kDa. The number of polypeptides in other seed protein fractions albumins, globulins and prolamins, varied from four to ten. One of the albumin bands had intrapolypeptide disulphide linkages （20 kDa） and the globulins contained two such bands （13.5 and 20 kDa）. Thus, the present study provides a description of the polypeptide composition of different rice protein fractions that is finely resolved with respect to the occurrence of disulphide linkages.
文摘Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far, several sufur-rich seed protein genes have been isolated and the essential amino acid contents of seed proteins were increased in transgenic tobacco and Brassica napus. In this paper we report the isolation and sequencing of the 10kd prolamin gene from seeds. Poly(A) RNA were prepared from the immature endosperms of japonica rice, Sachiminori, 10 d after flowering. Complementary DNAs were synthesized according to Promega Instruction Manual. Two primers were synthesized and their sequences were Primer Ⅰ: CGTCTACACCATCTGGAATC, Primer Ⅱ: GTGTTTGCAGATAGTATGC. The amplified fragraents were inserted into the Sma I site of pGEM-7zf(+) and was used to transform E. coli JM101 after PCR reaction. DNA sequence were determined by Sanger’s Chain-termination method. Synthesis of cDNA. Using mRNAs as
基金supported by grants from the National Natural Science Foundation of China(NSFC31871396,32000208,32070769)the Science and Technology Innovation Program of Hunan Province(2020WK2014)+2 种基金the Changsha Municipal Natural Science Foundation(kq2014039)the Scientific Innovation Fund for Post-graduates of Central South University of Forestry and Technology(CX202101026)the Postgraduate Scientific Research Innovation Project of Hunan Province(CX20210844)。
文摘Rice(Oryza sativa L.)is the most important food crop for at least half of the world’s population.Due to improved living standards,the cultivation of high-quality rice for different purposes and markets has become a major goal.Rice quality is determined by the presence of many nutritional components,including seed storage proteins(SSPs),which are the second most abundant nutrient components of rice grains after starch.Rice SSP biosynthesis requires the participation of multiple organelles and is influenced by the external environment,making it challenging to understand the molecular details of SSP biosynthesis and improve rice protein quality.In this review,we highlight the current knowledge of rice SSP biosynthesis,including a detailed description of the key molecules involved in rice SSP biosynthetic processes and the major environmental factors affecting SSP biosynthesis.The effects of these factors on SSP accumulation and their contribution to rice quality are also discussed based on recent findings.This recent knowledge suggests not only new research directions for exploring rice SSP biosynthesis but also innovative strategies for breeding high-quality rice varieties.
基金Project supported by Rockefeller Foundation for International Program on Rice Biotechnology.
文摘The 5’ upstream region (—680—+40) containing the complete signal peptide coding sequence of the rice seed storage prolamin gene was amplified in vitro with polymerase chain reaction from the genome of Chinese super rice cultivar Zhonghua 8. Physical map and DNA sequence analysis showed strong homology with the 5’-flanking region of rice prolamin gene reported by Kim in 1988. No changes in the signal peptide coding sequence and a long leader sequence with several small ORFs were found. Chimeric gene containing 5’-flanking region of the prolamin gene has been transcriptionally fused with the β-glucuronidase reporter gene. The fusion junction was confirmed by both physical map and DNA sequence analysis. The resultant chimeric gene was used to transform the tabacco explants by Ti binary system of Agrobacterium tumefaciens LBA4404. With dot and Southern blotting hybridization, three transgenic tobacco plants with the copies of chimeric GUS genes as many as 20 were obtained. Histochemical analysis
基金supported by China National Major Research and Development Plan (Grant No. 0111900)National Natural Science Foundation of China (Grant No. 32000143)+1 种基金Zhejiang Provincial Natural Science Foundation of China (Grant No. LQ20C020002) at China Jiliang Universityby U.S. National Science Foundation (Grant No. IOS1456300 and IOS1758767) at Purdue University.
文摘A central role of the endoplasmic reticulum(ER)is the synthesis,folding and quality control of secretory proteins.Secretory proteins usually exit the ER to enter the Golgi apparatus in coat protein complex II(COPII)-coated vesicles before transport to different subcellular destinations.However,in plants there are specialized ER-derived vesicles(ERDVs)that carry specific proteins but,unlike COPII vesicles,can exist as independent organelles or travel to the vacuole in a Golgi-independent manner.These specialized ERDVs include protein bodies and precursor-accumulating vesicles that accumulate storage proteins in the endosperm during seed development.Specialized ERDVs also include precursor protease vesicles that accumulate amino acid sequence KDEL-tailed cysteine proteases and ER bodies in Brassicales plants that accumulate myrosinases that hydrolyzes glucosinolates.These functionally specialized ERDVs act not only as storage organelles but also as platforms for signal-triggered processing,activation and deployment of specific proteins with important roles in plant growth,development and adaptive responses.Some specialized ERDVs have also been exploited to increase production of recombinant proteins and metabolites.Here we discuss our current understanding of the functional diversity,evolutionary mechanisms and biotechnological application of specialized ERDVs,which are associated with some of the highly remarkable characteristics important to plants.
