Optimization of a Reaction System of Sequence Related Amplified Polymorphism and Segregation of Polymorphic Loci in an F_2 Population of Rice

An effective PCR protocol for detecting the sequence related amplified polymorphism （SRAP） in rice was developed. One hundred and ten pairs of SRAP primers were used for segregation analysis in an F2 population derived from a cross between Shennong 606 and Lijiangxintuanheigu. Among the 110 primer pairs, 35 pairs generated 143 polymorphic bands with an average of 4.09 polymorphic bands per primer pair, and 24 pairs （16.78%） showed the genetic distortion （P〈0.05）. Of the 24 primer pairs, 12 pairs deviated toward the male parent Shennong 606 and 11 pairs toward the female parent Lijiangxintuanheigu, only one toward heterozygote. It was found that the segregation distortion might be caused by the joint gametic and zygotic effects.

Amplification and sequencing of a sulfur-rich 10kd prolamin gene from rice seeds

Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far, several sufur-rich seed protein genes have been isolated and the essential amino acid contents of seed proteins were increased in transgenic tobacco and Brassica napus. In this paper we report the isolation and sequencing of the 10kd prolamin gene from seeds. Poly(A) RNA were prepared from the immature endosperms of japonica rice, Sachiminori, 10 d after flowering. Complementary DNAs were synthesized according to Promega Instruction Manual. Two primers were synthesized and their sequences were Primer Ⅰ: CGTCTACACCATCTGGAATC, Primer Ⅱ: GTGTTTGCAGATAGTATGC. The amplified fragraents were inserted into the Sma I site of pGEM-7zf(+) and was used to transform E. coli JM101 after PCR reaction. DNA sequence were determined by Sanger’s Chain-termination method. Synthesis of cDNA. Using mRNAs as

Development and Application of SCAR Markers for Discriminating Cytoplasmic Male Sterile Lines from Their Cognate Maintainer Lines in Indica Rice

The DNAfragments about 1 600 bp were amplified using random amplified polymorphism DNA （RAPD） primer OPAl2 with the templates of mitochondrial DNA of Zhenshan 97A and Zhenshan 97B, and were sequenced. The nucleotide sequences and lengths of the fragments from Zhenshan 97A and Zhenshan 97B showed no difference. The precise length of the fragment was 1 588 bp. Sequence characterized amplification region （SCAR） primers were then developed to discriminate the cytoplasmic male sterile （CMS） lines and their maintainer lines. A specific 1 588 bp fragment could be amplified with SCAR primers, CHI19F2/CHI19R2 and CHI20F3/CHI23R3, in the mitochondrial DNA of Zhenshan 97A, but not Zhenshan 97B. Furthermore, the specific fragment could be also amplified from the total DNA from green leaf tissues of Zhenshan 97A with SCAR primers, but not Zhenshan 97B. With the corresponding primers, the specific fragment could also be amplified from the total DNA of green leaves of other two CMS lines with wild abortive type cytoplasm （CMS-WA）, namely Zhenpin A and Tianfeng A, but not in their maintainer lines. Moreover, using total DNA as template, each of the four pairs of SCAR primers could also be used to amplify the 1 588 bp fragment in CMS-ID （Indonesia paddy type） line 11-32A but not in 11-32B, and the specific fragment was amplified from the DNA of both F1 and F2 seedlings of Shanyou 63. The results of detecting the genetic purity of a man-made mixture of the seeds of Zhenshan 97A using CHI20F3/CHI23R3 were completely consistent with the phenotypes. Taken together, these results indicated that the specific 1 588 bp-fragment amplified by CHI20F3/CHI23R3 was the unique amplification products of CMS mitochondrial DNA, and could be used to distinguish CMS-WA and CMS-ID lines from their corresponding maintainer lines at the seedling stage.