The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the o...The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.展开更多
Fusion power output is proportional not only to the fuel particle number densities participating in reaction but also to the fusion reaction rate coefficient （or reactivity）, which is dependent on reactant velocity ...Fusion power output is proportional not only to the fuel particle number densities participating in reaction but also to the fusion reaction rate coefficient （or reactivity）, which is dependent on reactant velocity distribution functions. They are usuMly assumed to be dual Maxwellian distribution functions with the same temperature for thermal nuclear fusion circumstances. However, if high power neutral beam injection and minority ion species ICRF plasma heating, or multi-pinched plasma beam head-on collision, in a converging region are required and investigated in future large scale fusion reactors, then the fractions of the injected energetic fast ion tail resulting from ionization or charge exchange will be large enough and their contribution to the non-Maxwellian distribution functions is not negligible, hence to the fusion reaction rate coefficient or calculation of fusion power. In such cases, beam-target, and beam-beam reaction enhancement effect contributions should play very important roles. In this paper, several useful formulae to calculate the fusion reaction rate coefticient for different beam and target combination scenarios are derived in detail展开更多
基金supported by the National Transgenic Project of China (2016ZX08010001-002 and 2016ZX08010005-001)the National Natural Science Foundation of China (81471001)the Inner Mongolia Science and Technology Program, China (201502073)
文摘The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.
基金Supported by the International Thermonuclear Experimental Reactor Project of China under Grant No 2013GB114003the National Natural Science Foundation of China under Grant No 11275135
文摘Fusion power output is proportional not only to the fuel particle number densities participating in reaction but also to the fusion reaction rate coefficient （or reactivity）, which is dependent on reactant velocity distribution functions. They are usuMly assumed to be dual Maxwellian distribution functions with the same temperature for thermal nuclear fusion circumstances. However, if high power neutral beam injection and minority ion species ICRF plasma heating, or multi-pinched plasma beam head-on collision, in a converging region are required and investigated in future large scale fusion reactors, then the fractions of the injected energetic fast ion tail resulting from ionization or charge exchange will be large enough and their contribution to the non-Maxwellian distribution functions is not negligible, hence to the fusion reaction rate coefficient or calculation of fusion power. In such cases, beam-target, and beam-beam reaction enhancement effect contributions should play very important roles. In this paper, several useful formulae to calculate the fusion reaction rate coefticient for different beam and target combination scenarios are derived in detail
