In order to determine the level of resistance of sugar beet varieties against Rhizoctonia solani AG 2-21IIB and AG 4, a methodology was implemented under greenhouse conditions that contemplated the most important crit...In order to determine the level of resistance of sugar beet varieties against Rhizoctonia solani AG 2-21IIB and AG 4, a methodology was implemented under greenhouse conditions that contemplated the most important criteria regarding to plant-pathogen interaction. The effect of plant growth stage on the development of the disease was evaluated. Seven sugar beet varieties were tested for resistance to R. solani AG 2-2IIIB and AG 4. To detect differences in leaf temperature between/L solani inoculated plants and non-infected plants, an infrared （IR） camera was tested. High incidence of R. solani AG 2-2IIIB and AG 4 in sugar beet plants was evident when the fungal inoculum was applied to two and four weeks old plants. At four weeks after sowing, it was the optimum time to inoculate sugar beet plants in order to generate R. solani infection, since at this time all plants were infected. Significant differences were detected regarding disease incidence between sugar beet varieties inoculated with different anastomosis groups. Leaf temperature was significant different between inoculated and non-inoculated plants, demonstrated that this technique could be a new tool for breeders to screen for resistance of new varieties.展开更多
Decomposed manure extracts of cattle, sheep, poultry, horse and their composition of antagonistic fungi were evaluated to suppress phytopathogen Rhizoctonia solani, one of the most important causes of chickpea damping...Decomposed manure extracts of cattle, sheep, poultry, horse and their composition of antagonistic fungi were evaluated to suppress phytopathogen Rhizoctonia solani, one of the most important causes of chickpea damping-off. In vitro, the dual culture test used the criteria to evaluate antagonistic potential of fungal isolates that associated with different manures, in addition to assessment severity of Rhizoctonial damping-off of chickpea seedlings in potting media Penicillium sp., Aspergillus niger and Aspergillus terreus were highly colonized each of manure extract. Results of dual culture observed the significant reduction of the pathogens mycelial growth （70.9%） when one disc of R. solani was placed in the center and three discs of antagonistic were placed in the periphery of plates. However, the mycelial growth of R. solani evidenced a higher inhibition （48.62%） when cultured with the antagonistic of Penicillium sp.. Sheep and poultry manure extracts reduced the pathogen＇s growth by 47.24% and 49.2%, respectively. Severity rating of Rhizoctonial damping-off was decreased to 0.2 when using poultry manure containing antagonistic fungus of A. terreus, other treatments of composted soil were similarized in their results of disease index.展开更多
Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA...Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.展开更多
文摘In order to determine the level of resistance of sugar beet varieties against Rhizoctonia solani AG 2-21IIB and AG 4, a methodology was implemented under greenhouse conditions that contemplated the most important criteria regarding to plant-pathogen interaction. The effect of plant growth stage on the development of the disease was evaluated. Seven sugar beet varieties were tested for resistance to R. solani AG 2-2IIIB and AG 4. To detect differences in leaf temperature between/L solani inoculated plants and non-infected plants, an infrared （IR） camera was tested. High incidence of R. solani AG 2-2IIIB and AG 4 in sugar beet plants was evident when the fungal inoculum was applied to two and four weeks old plants. At four weeks after sowing, it was the optimum time to inoculate sugar beet plants in order to generate R. solani infection, since at this time all plants were infected. Significant differences were detected regarding disease incidence between sugar beet varieties inoculated with different anastomosis groups. Leaf temperature was significant different between inoculated and non-inoculated plants, demonstrated that this technique could be a new tool for breeders to screen for resistance of new varieties.
文摘Decomposed manure extracts of cattle, sheep, poultry, horse and their composition of antagonistic fungi were evaluated to suppress phytopathogen Rhizoctonia solani, one of the most important causes of chickpea damping-off. In vitro, the dual culture test used the criteria to evaluate antagonistic potential of fungal isolates that associated with different manures, in addition to assessment severity of Rhizoctonial damping-off of chickpea seedlings in potting media Penicillium sp., Aspergillus niger and Aspergillus terreus were highly colonized each of manure extract. Results of dual culture observed the significant reduction of the pathogens mycelial growth （70.9%） when one disc of R. solani was placed in the center and three discs of antagonistic were placed in the periphery of plates. However, the mycelial growth of R. solani evidenced a higher inhibition （48.62%） when cultured with the antagonistic of Penicillium sp.. Sheep and poultry manure extracts reduced the pathogen＇s growth by 47.24% and 49.2%, respectively. Severity rating of Rhizoctonial damping-off was decreased to 0.2 when using poultry manure containing antagonistic fungus of A. terreus, other treatments of composted soil were similarized in their results of disease index.
文摘Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.
