To develop a new DNA maker, which could be used in genetic diversity analysis and genetic map construction in plants, IT-ISJ （intron targeted intron-exon splice junction） primer combinations, which were designed acc...To develop a new DNA maker, which could be used in genetic diversity analysis and genetic map construction in plants, IT-ISJ （intron targeted intron-exon splice junction） primer combinations, which were designed according to the intronexon splice junction conserved sequences, were used to construct cotton genetic linkage map in the present study. 49 out of 704 IT-ISJ primer combinations showed polymorphism between upland cotton high quality cultivar Yumian 1 and multiple dominant gene line T586, and the polymorphic primer combinations accounted for 7.0% of total primer combinations. 49 IT-ISJ primer combinations were used to genotype 270 F2：7 recombinant inbred lines developed from （Yumian 1 × T586） F2, and 58 IT-ISJ loci were obtained. 58 IT-ISJ, together with 150 SSR and 8 morphological loci, were used to conduct linkage analysis, and a linkage map including 22 linkage groups and 113 loci （49 IT-ISJ, 62 SSR, and 2 morphological loci） was constructed. The linkage map covered 714.5 cM with an average interval of 6.3 cM between two markers, accounting for 16.1% of cotton genome. The present study demonstrated that the polymorphism of IT-ISJ marker is high, and it could be effectively applied in plant genetic map construction.展开更多
This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
There exists a single nucleotide polymorphism, G or T, at the first base of the donor splice site of waxy gene intron 1 in rice. In order to study the relationship between the first base of the donor splice site of wa...There exists a single nucleotide polymorphism, G or T, at the first base of the donor splice site of waxy gene intron 1 in rice. In order to study the relationship between the first base of the donor splice site of waxy gene intron 1 and amylose content in rice, the one-step PCR method was used to determine whether it is G or T in 220 Yunnan indigenous rice varieties from 14 districts, 55 towns/counties of Yunnan Province, and 101 varieties of which were validated by the PCR-Acc I method. According to the G/T polymorphism, 164 rice varieties showed GG-genotype, while the other 56 fell into TT- genotype, accounting for 74.5% and 25.5% of all the test varieties, respectively. When all the rice varieties were divided into indica and japonica subspecies, it was found that 80.5% of indica rice and 67.0% of japonica rice belonged to GG-genotype. The rice varieties with GG-genotype had significantly higher amylose content （18.95% on average） than those with TT- genotype （all below 16%）, but 33 rice varieties with GG-genotype still had low amylose content ranging from 3.91% to 15.93%, and most of them came from the Dai minority area in the Southwest of Yunnan Province. However, there was no significant difference in the mean amylose content of the same GG or TT genotypes between indica and japonica rice, suggesting that different genetic backgrounds, indica or japonica, had no effect on amylose content. The coefficient of correlation between the genotype and amylose content was 0.733 （P〈0.01）.展开更多
AIM:To investigate p53 mutations in esophageal cancer in a high-risk population,and correlate them with smoking,alcohol consumption and betel chewing.METHODS:One hundred and sixty-five tumor samples of esophageal squa...AIM:To investigate p53 mutations in esophageal cancer in a high-risk population,and correlate them with smoking,alcohol consumption and betel chewing.METHODS:One hundred and sixty-five tumor samples of esophageal squamous cell carcinoma(ESCC) obtained from a university hospital in Songkhla province,Southern Thailand were investigated for p53 mutations in exons 5-8,using polymerase chain reaction-single strand conformation polymorphism analysis,followed by direct sequencing.A polymerase chain reactionrestriction fragment length polymorphism(RFLP) assay was additionally used to confirm possible germline mutation in intron 6.A history of risk habits was obtained by interviews.The association between risk habits and mutation frequency was evaluated using the χ 2 test.RESULTS:The studied specimens were from 139 male and 26 female patients with ESCC,treated at Songklanagarind Hospital.Most of the patients were smokers(86.7%) and alcohol consumers(72.73%),and 38.3% were betel chewers.Forty-three mutations of the p53 gene were detected in 25.5%(42/165) of tumor samples.Mutations were most commonly found in exon 5(25.6%) and exon 8(25.6%).Mutations in the hot-spot codon 248 were found in four cases(9.3% of all mutations).G:C→C:G(30.23%),G:C→A:T(27.90%) and G:C →T:A(16.28%) were the prevalent spectra of mutations.Unexpectedly,among 10 intronic mutations,eight cases harbored a similar mutation:G→C substitution in intron 6(nucleotide 12759,GenBank NC_000017).These were additionally confirmed by the RFLP technique.Similar mutations were also detected in their matched blood samples using RFLP and direct sequencing,which suggested germline mutations.There was no significant correlation between risk habits and p53 mutation frequency.CONCLUSION:A proportion of Thai ESCC patients harbored specific intronic p53 mutations,which might be germline mutations.Further studies are needed to explore this novel finding.展开更多
Lentil(Lens culinaris Medik) is one of the most important food legumes in the world. The use in lentil of molecular marker-assisted breeding is limited, owing to the low availability of polymorphic markers. In the pre...Lentil(Lens culinaris Medik) is one of the most important food legumes in the world. The use in lentil of molecular marker-assisted breeding is limited, owing to the low availability of polymorphic markers. In the present study, we developed a set of polymorphic intron-spanning markers(ISMs) using a cross-species mapping approach. In this approach, putative unique transcripts(PUTs) of L. culinaris were mapped onto the Medicago truncatula genome, exploiting its closeness with the lentil genome. Spliced alignment of the PUTs resulted in a total of 25,717 alignments, allowing the development of 1703 ISMs. From these, a subset of 105 ISMs were synthesized and validated with a 51% amplification success rate in 32 lentil genotypes. Of these ISMs, 40(74%) were polymorphic and generated 2–11 alleles per locus in a genetically diverse panel of 32 lentil genotypes including wild species.This set of polymorphic ISMs along with their functional annotation data will be useful in lentil breeding.展开更多
As a component of genes, introns are much more variable than exons. Therefore, introns are an important source of genetic polymorphisms and can be used as genetic markers. By designing PCR primers in the two
Inter-reference of competitive reverse transcription polymerase chain reaction (RT-PCR)was constructed by intron method to detect the change of PC mRNA level in the pathway ofcarbohydrate metabolism. The experiment ba...Inter-reference of competitive reverse transcription polymerase chain reaction (RT-PCR)was constructed by intron method to detect the change of PC mRNA level in the pathway ofcarbohydrate metabolism. The experiment based on the principle that 81bp intron sequencewas deleted in PC mRNA compared with PC DNA sequence. The 466bp competitive DNA templaterecombinant plasmid of PC mRNA was successfully built by a pair of primer and was clonedonce, PC DNA and PC mRNA could be inter-referred each other. The intron approach used inthe experiment has broken through the traditional method of constructing competitivetemplate.展开更多
Objective Hemophilia A,an X-linked bleeding disorder,affecting 1 in 5 000 males is caused by heterogeneous mutations in factor Ⅷ gene.Inversion mutation in intron 22 of F8C gene remains its leading cause.The aim of t...Objective Hemophilia A,an X-linked bleeding disorder,affecting 1 in 5 000 males is caused by heterogeneous mutations in factor Ⅷ gene.Inversion mutation in intron 22 of F8C gene remains its leading cause.The aim of this study was to evaluate the frequency and distribution of the intron 22-inversion mutation in the patients and in the family members in the region.Methods 29 hemophilia A patients from Jammu and Kashmir(20 severe,8 moderate and 1 mild) were analyzed for intron 22-inversion mutation.Results 11(38%) were positive for the distal type of inversion mutation.The mutation was found in 9/20(45%) patients with severe factor Ⅷ deficiency and 2/8(25%) with moderate severity hemophilia A,whereas the patient with mild hemophilia A was found to be negative for inversion mutation.Evaluation of twenty-six female relatives from 11 families of inversion mutation positive patients identified one mother and one sister from one family to be the carrier,suggesting its origin in the mother. Conclusion The present study confirms the intron-22 inversion mutation in F8C gene as the major cause of hemophilia A in the population from Jammu and Kashmir with a higher frequency of inversion mutation in sporadic cases compared to the familial cases.展开更多
基金the National Natural Science Foundation of China (30370898,30571187, 30871556)National High Tech Research and Development Program of China (2006AA10Z1D3,2006AA100105)
文摘To develop a new DNA maker, which could be used in genetic diversity analysis and genetic map construction in plants, IT-ISJ （intron targeted intron-exon splice junction） primer combinations, which were designed according to the intronexon splice junction conserved sequences, were used to construct cotton genetic linkage map in the present study. 49 out of 704 IT-ISJ primer combinations showed polymorphism between upland cotton high quality cultivar Yumian 1 and multiple dominant gene line T586, and the polymorphic primer combinations accounted for 7.0% of total primer combinations. 49 IT-ISJ primer combinations were used to genotype 270 F2：7 recombinant inbred lines developed from （Yumian 1 × T586） F2, and 58 IT-ISJ loci were obtained. 58 IT-ISJ, together with 150 SSR and 8 morphological loci, were used to conduct linkage analysis, and a linkage map including 22 linkage groups and 113 loci （49 IT-ISJ, 62 SSR, and 2 morphological loci） was constructed. The linkage map covered 714.5 cM with an average interval of 6.3 cM between two markers, accounting for 16.1% of cotton genome. The present study demonstrated that the polymorphism of IT-ISJ marker is high, and it could be effectively applied in plant genetic map construction.
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
文摘There exists a single nucleotide polymorphism, G or T, at the first base of the donor splice site of waxy gene intron 1 in rice. In order to study the relationship between the first base of the donor splice site of waxy gene intron 1 and amylose content in rice, the one-step PCR method was used to determine whether it is G or T in 220 Yunnan indigenous rice varieties from 14 districts, 55 towns/counties of Yunnan Province, and 101 varieties of which were validated by the PCR-Acc I method. According to the G/T polymorphism, 164 rice varieties showed GG-genotype, while the other 56 fell into TT- genotype, accounting for 74.5% and 25.5% of all the test varieties, respectively. When all the rice varieties were divided into indica and japonica subspecies, it was found that 80.5% of indica rice and 67.0% of japonica rice belonged to GG-genotype. The rice varieties with GG-genotype had significantly higher amylose content （18.95% on average） than those with TT- genotype （all below 16%）, but 33 rice varieties with GG-genotype still had low amylose content ranging from 3.91% to 15.93%, and most of them came from the Dai minority area in the Southwest of Yunnan Province. However, there was no significant difference in the mean amylose content of the same GG or TT genotypes between indica and japonica rice, suggesting that different genetic backgrounds, indica or japonica, had no effect on amylose content. The coefficient of correlation between the genotype and amylose content was 0.733 （P〈0.01）.
基金Supported by The Annual Research Fund of the National Research Council of Thailand
文摘AIM:To investigate p53 mutations in esophageal cancer in a high-risk population,and correlate them with smoking,alcohol consumption and betel chewing.METHODS:One hundred and sixty-five tumor samples of esophageal squamous cell carcinoma(ESCC) obtained from a university hospital in Songkhla province,Southern Thailand were investigated for p53 mutations in exons 5-8,using polymerase chain reaction-single strand conformation polymorphism analysis,followed by direct sequencing.A polymerase chain reactionrestriction fragment length polymorphism(RFLP) assay was additionally used to confirm possible germline mutation in intron 6.A history of risk habits was obtained by interviews.The association between risk habits and mutation frequency was evaluated using the χ 2 test.RESULTS:The studied specimens were from 139 male and 26 female patients with ESCC,treated at Songklanagarind Hospital.Most of the patients were smokers(86.7%) and alcohol consumers(72.73%),and 38.3% were betel chewers.Forty-three mutations of the p53 gene were detected in 25.5%(42/165) of tumor samples.Mutations were most commonly found in exon 5(25.6%) and exon 8(25.6%).Mutations in the hot-spot codon 248 were found in four cases(9.3% of all mutations).G:C→C:G(30.23%),G:C→A:T(27.90%) and G:C →T:A(16.28%) were the prevalent spectra of mutations.Unexpectedly,among 10 intronic mutations,eight cases harbored a similar mutation:G→C substitution in intron 6(nucleotide 12759,GenBank NC_000017).These were additionally confirmed by the RFLP technique.Similar mutations were also detected in their matched blood samples using RFLP and direct sequencing,which suggested germline mutations.There was no significant correlation between risk habits and p53 mutation frequency.CONCLUSION:A proportion of Thai ESCC patients harbored specific intronic p53 mutations,which might be germline mutations.Further studies are needed to explore this novel finding.
基金supported by the National Natural Science Fund of China (30970231)the Genetically Modified Organisms Breeding Major Project of China (2014ZX08003001)
文摘supported by the National Natural Science Fund of China （30970231）;the Genetically Modified Organisms Breeding Major Project of China （2014ZX08003001）
基金the Indian Council of Agricultural Research,New Delhi,India for research supportpartially funded by the Department of Biotechnology,Government of India,New Delhi,India through a grant support(BT/PR10921/AG11/106/943/2014)
文摘Lentil(Lens culinaris Medik) is one of the most important food legumes in the world. The use in lentil of molecular marker-assisted breeding is limited, owing to the low availability of polymorphic markers. In the present study, we developed a set of polymorphic intron-spanning markers(ISMs) using a cross-species mapping approach. In this approach, putative unique transcripts(PUTs) of L. culinaris were mapped onto the Medicago truncatula genome, exploiting its closeness with the lentil genome. Spliced alignment of the PUTs resulted in a total of 25,717 alignments, allowing the development of 1703 ISMs. From these, a subset of 105 ISMs were synthesized and validated with a 51% amplification success rate in 32 lentil genotypes. Of these ISMs, 40(74%) were polymorphic and generated 2–11 alleles per locus in a genetically diverse panel of 32 lentil genotypes including wild species.This set of polymorphic ISMs along with their functional annotation data will be useful in lentil breeding.
文摘As a component of genes, introns are much more variable than exons. Therefore, introns are an important source of genetic polymorphisms and can be used as genetic markers. By designing PCR primers in the two
基金supported by the National Natural Science Foundation of China(30230620).
文摘Inter-reference of competitive reverse transcription polymerase chain reaction (RT-PCR)was constructed by intron method to detect the change of PC mRNA level in the pathway ofcarbohydrate metabolism. The experiment based on the principle that 81bp intron sequencewas deleted in PC mRNA compared with PC DNA sequence. The 466bp competitive DNA templaterecombinant plasmid of PC mRNA was successfully built by a pair of primer and was clonedonce, PC DNA and PC mRNA could be inter-referred each other. The intron approach used inthe experiment has broken through the traditional method of constructing competitivetemplate.
文摘Objective Hemophilia A,an X-linked bleeding disorder,affecting 1 in 5 000 males is caused by heterogeneous mutations in factor Ⅷ gene.Inversion mutation in intron 22 of F8C gene remains its leading cause.The aim of this study was to evaluate the frequency and distribution of the intron 22-inversion mutation in the patients and in the family members in the region.Methods 29 hemophilia A patients from Jammu and Kashmir(20 severe,8 moderate and 1 mild) were analyzed for intron 22-inversion mutation.Results 11(38%) were positive for the distal type of inversion mutation.The mutation was found in 9/20(45%) patients with severe factor Ⅷ deficiency and 2/8(25%) with moderate severity hemophilia A,whereas the patient with mild hemophilia A was found to be negative for inversion mutation.Evaluation of twenty-six female relatives from 11 families of inversion mutation positive patients identified one mother and one sister from one family to be the carrier,suggesting its origin in the mother. Conclusion The present study confirms the intron-22 inversion mutation in F8C gene as the major cause of hemophilia A in the population from Jammu and Kashmir with a higher frequency of inversion mutation in sporadic cases compared to the familial cases.
