A set of representative 146 adzuki (Vigna angular is var. angularis, and var. nipponensis) germplasm from 6 Asian countries traditionally for adzuki bean production, together with an out group standard rice bean (Vign...A set of representative 146 adzuki (Vigna angular is var. angularis, and var. nipponensis) germplasm from 6 Asian countries traditionally for adzuki bean production, together with an out group standard rice bean (Vigna umbellata), were analyzed by AFLP methodology using 12 informative primer pairs. 313 unambiguous polymorphic bands were created. According to the dendrogram by cluster analysis based on AFLP banding, 143 of the accessions were distinct and revealed enough genetic diversity for identification and classification of accessions within Vigna angularis. A neighbor joining tree was generated using newly developed Innan's nucleotide diversity estimate from the AFLP data. From analysis, 7 distinct evolutionary groups, named as "Chinese cultivated", "Japanese cultivated", "Japanese complex-Korean cultivated", "Chinese wild", "China Taiwan wild", "Nepal-Bhutan cultivated" and "Hymalayan wild", were detected. Nucleotide diversity with geographical distribution of each group is discussed, regarding the evolutionary relationships between wild and cultivated adzuki beans. The preliminary results indicated that cultivated adzuki bean should be domesticated from at least 4 progenitors in at least 3 geographical origins.展开更多
This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
文摘A set of representative 146 adzuki (Vigna angular is var. angularis, and var. nipponensis) germplasm from 6 Asian countries traditionally for adzuki bean production, together with an out group standard rice bean (Vigna umbellata), were analyzed by AFLP methodology using 12 informative primer pairs. 313 unambiguous polymorphic bands were created. According to the dendrogram by cluster analysis based on AFLP banding, 143 of the accessions were distinct and revealed enough genetic diversity for identification and classification of accessions within Vigna angularis. A neighbor joining tree was generated using newly developed Innan's nucleotide diversity estimate from the AFLP data. From analysis, 7 distinct evolutionary groups, named as "Chinese cultivated", "Japanese cultivated", "Japanese complex-Korean cultivated", "Chinese wild", "China Taiwan wild", "Nepal-Bhutan cultivated" and "Hymalayan wild", were detected. Nucleotide diversity with geographical distribution of each group is discussed, regarding the evolutionary relationships between wild and cultivated adzuki beans. The preliminary results indicated that cultivated adzuki bean should be domesticated from at least 4 progenitors in at least 3 geographical origins.
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
