Background: The effect of amylases combined with exogenous carbohydrase and protease in a newly harvested corn diet on starch digestibility, intestine health and cecal microbiota was investigated in broiler chickens.M...Background: The effect of amylases combined with exogenous carbohydrase and protease in a newly harvested corn diet on starch digestibility, intestine health and cecal microbiota was investigated in broiler chickens.Methods: Two hunderd and eighty-eight 5-day-old female chickens were randomly divided into six treatments: a newly harvested corn-soybean meal diet(control); control supplemented with 1,500 U/g α-amylase(Enzyme A);Enzyme A + 300 U/g amylopectase + 20,000 U/g glucoamylase(Enzyme B); Enzyme B + protease 10,000 U/g(Enzyme C); Enzyme C + xylanase 15,000 U/g(Enzyme D); and Enzyme D + cellulase 200 U/g + pectinase 1,000 U/g(Enzyme E). Growth performance, starch digestibility, digestive organ morphology, and intestinal microbiota were evaluated in the birds at 16 and 23 d of age.Results: Compared with the control diet, supplementation with Enzyme A significantly decreased ileum lesion scoring at 16 d of age(P < 0.05); supplementation with Enzyme B or Enzyme C showed positive effects on ileal amylopectin and total starch digestibility(P < 0.05); Broilers fed with a diet supplemented with Enzyme D had a tendency to decrease body weight gain at 23 d. Enzyme E supplementation improved lesion scoring of jejunum and ileum at 16 d(P < 0.05), and increased ileal amylopectin or total starch digestibility at 23 d(P < 0.05).Supplementation of enzymes changed cecal microbiota diversity. High numbers of Campylobacter, Helicobacter and Butyricicoccus, Anaerostipes and Bifidobacterium, Sutterella and Odoribacter were the main genera detected in supplementations with Enzymes B, C, D, and E respectively.Conclusions: Supplementation with amylase combined with glucoamylase or protease showed a beneficial effect on starch digestibility and intestinal microbiota diversity, and increased growth of broilers fed with newly harvested corn.展开更多
The changes in the activity of amylase and amylase-isoenzyme and the degradation of starch and pigment of tobacco leaf during flue-curing were studied by using the electric- heated flue-curing barn designed and made...The changes in the activity of amylase and amylase-isoenzyme and the degradation of starch and pigment of tobacco leaf during flue-curing were studied by using the electric- heated flue-curing barn designed and made by the Henan Agricultural University. The temperature and humidity of the barn were controlled automatically. The results indicated that starch in tobacco leaf decreased rapidly and leveled off after 48 h of curring, in the meantime, the content of soluble sugar increased accordingly and reached a peak at the stage of color-fixing. Both of them had a rapid-changing stage in the first 36 hours of yellowing. The changes of starch and soluble sugar contents had highly significant negative-correlation at 1 % level (rNC89 = -0.8962**, rYY85 = -0.9704**). The activity of amylase increased with the proceeding of curing and reached a peak after 36 hours of curing, then decreased. But the activity of amylase kept at a high level when the humidity of curing-environment was very low, even if the tobacco leaf had been dried. The rapid degradation of starch showed a significantly negative correlation with the increase of activity of amylase at 5 % level (rNC89 = -0.8495*, rYY85 = -0.7839*). The degradation of starch and pigment had the same regulation and had highly significant correlation at 1 % level (rNC89= 0.9649**, rYY85= 0.9428**). There were mainly three amylase-isoenzyme bands -A, B, C respectively, in tobacco leaf during flue curing. They were identified as α-AMY, β-AMY, R-AMY, and the activity of β-AMY was the highest. The changes in amylase activity and contents of starch and pigment were affected by the tobacco leaf moisture and environmental humidity during curing.展开更多
Postprandial hyperglycemia is an early indication of type 2 diabetes and the target of many anti-diabetic and anti-obesity studies.α-Glucosidase and α-amylase are the crucial factors in regulating starch digestion a...Postprandial hyperglycemia is an early indication of type 2 diabetes and the target of many anti-diabetic and anti-obesity studies.α-Glucosidase and α-amylase are the crucial factors in regulating starch digestion and glucose absorption,making them key targets for many studies to treat postprandial hyperglycemia.We studied the inhibitory activities of microalgal fucoxanthin against rat-intestinalα-glucosidase and pancreaticα-amylase along with the antidiabetic eff ect to induce diff erentiation in 3T3-L1 pre-adipocytes using Oil Red-O staining.Fucoxanthin displayed strong hindrance activities towardα-amylase in a concentration-dependent manner,with an IC50 value of 0.68mmol/L,whereas weak inhibitory activity against α-glucosidase,with an IC 50 value of 4.75 mmol/L.Fucoxanthin also considerably elevated glucose oxidase activity in 3T3-L1 cells by 31.3%at 5μmol/L.During adipocyte differentiation,fucoxanthin showed lipid accumulation in 3T3-L1 cells with no cytotoxicity up to 20μmol/L.However,fucoxanthin had no inhibitory activity on glucose-6-phosphate dehydrogenase.These results suggest that fucoxanthin might be useful for the prevention of obesity or diabetes by inhibiting carbohydrate-hydrolyzing enzymes and lipid accumulation and be utilized as an ingredient for a functional food or dietary supplement.展开更多
For the last decade, low serum amylase(hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes(regardless of type), and metabolic syndrome, all of which appear to have ...For the last decade, low serum amylase(hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes(regardless of type), and metabolic syndrome, all of which appear to have a common etiology of insufficient insulin action due to insulin resistance and/or diminished insulin secretion. Some clinical studies have shown that salivary amylase may be preferentially decreased in obese individuals, whereas others have revealed that pancreatic amylase may be preferentially decreased in diabetic subjects with insulin dependence. Despite this accumulated evidence, the clinical relevance of serum, salivary, and pancreatic amylase and the underlying mechanisms have not been fully elucidated. In recent years, copy number variations(CNVs) in the salivary amylase gene(AMY1), which range more broadly than the pancreatic amylase gene(AMY2A and AMY2B), have been shown to be well correlated with salivary and serum amylase levels. In addition, low CNV of AMY1, indicating low salivary amylase, was associated with insulin resistance, obesity, low taste perception/satiety, and postprandial hyperglycemia through impaired insulin secretion at early cephalic phase. In most populations, insulin-dependent diabetes is less prevalent(minor contribution) compared with insulin-independent diabetes, and obesity is highly prevalent compared with low body weight. Therefore, obesity as a condition that elicits cardiometabolic diseases relating to insulin resistance(major contribution) may be a common determinant for low serum amylase in a general population. In this review, the novel interpretation of low serum, salivary, and pancreas amylase is discussed in terms of major contributions of obesity, diabetes, and metabolic syndrome.展开更多
The marine yeast strain N13d, producing an extracellular amylase, was isolated from the deep sea sediments of the Pa-cific Ocean. This strain was identified to be Aureobasidium pullulans by 18S rRNA gene sequence anal...The marine yeast strain N13d, producing an extracellular amylase, was isolated from the deep sea sediments of the Pa-cific Ocean. This strain was identified to be Aureobasidium pullulans by 18S rRNA gene sequence analysis and routine yeast identi-fication methods. The optimal sea water medium for amylase production by this yeast strain was 1.0% peptone and 1.0% soluble starch with pH 4.0. The optimal conditions for amylase production by this yeast strain were with temperature 28 ℃, aeration rate 6 Lmin-1 and agitation speed 250 rmin-1. Under these conditions, 58.5 units of amylase activity per mg protein were produced within 56 h of fermentation.展开更多
BACKGROUND: Measurement of total serum amylase (AMY) is the most widely used biochemical test for the diagnosis of acute pancreatitis, but it is commonly considered a nonspecific marker. To improve the biochemical dia...BACKGROUND: Measurement of total serum amylase (AMY) is the most widely used biochemical test for the diagnosis of acute pancreatitis, but it is commonly considered a nonspecific marker. To improve the biochemical diagnosis of acute pancreatitis, lipase ( LIP ) and pancreatic amylase (PAMY) have been tested in recent years. The present study was designed to evaluate whether serum LIP and pancreatic PAMY tests could replace total amylase test to improve diagnostic efficiency in the evaluation of acute pancreatitis in patients with hyperamylasemia. METHODS: LIP and PAMY values were determined in serum samples from 92 patients with hyperamylasemia. Reference values for each enzyme were derived from serum samples of 147 healthy subjects. The activities of LIP and PAMY in patients with various diseases were shown directly by the boxplot graph. The diagnostic accuracy of LIP and PAMY was defined as the area under the receiver operating characteristic (ROC) curve. Their sensitivity and specificity in detecting acute pancreatitis at varying cutoff points were shown by the curve, and the best cutoff value for each enzyme was shown by the modified ROC curve. The diagnostic values of LIP, PAMY and LIP + AMY with each upper limit of reference range (ULR) were compared with the corresponding best cutoff values. RESULTS: The references values of LIP and PAMY were 12.2-47.6 U/L and 28-95 U/L, respectively. These values in patients with acute pancreatitis were higher than those patients with other diseases. The areas under the ROC curve ( AUC) of LIP and PAMY were 0. 799 and 0. 792, respectively, With the best diagnostic cutoff point of maximum (sensitivity + specificity) -100%, we obtained values of 97.9 U/L(LIP97.9 =2. 06 × ULR) for LIP and 209 U/L (PAMY209 =2.20 ×ULR) for PAMY. The best cutoff values for LIP, PAMY and LIP +AMY demonstrated the specificity, positive predictive value, and diagnostic efficiency higher than the corresponding ULRs. CONCLUSIONS: Serum LIP and PAMY are specific for the pancreas and might replace total amylase for the diagnosis of acute pancreatitis in hyperamylasemia patients. LIP97.9 is more efficient than PAMY209 in the diagnosis of acute pancreatitis. A combined test of both enzymes is not superior to single test of either enzyme in diagnostic accuracy.展开更多
AIM To estimate the efficacy of 2 h post-endoscopic retrograde cholangiopancreatography(ERCP) serum amylase levels and other factors for predicting postERCP pancreatitis.METHODS This was a retrospective,single-center ...AIM To estimate the efficacy of 2 h post-endoscopic retrograde cholangiopancreatography(ERCP) serum amylase levels and other factors for predicting postERCP pancreatitis.METHODS This was a retrospective,single-center cohort study of consecutive patients who underwent ERCP from January 2010 to December 2013.Serum amylase levels were measured 2 h post-procedure,and patient- and procedure-related pancreatitis(PEP) risk factors wereanalyzed using a logistic model.RESULTS A total of 1520 cases(average age 72 ± 12 years,60% male) were initially enrolled in this study,and 1403 cases(725 patients) were ultimately analyzed after the exclusion of 117 cases.Fifty-five of these cases developed PEP.We established a 2 h serum amylase cutoff level of two times the upper limit of normal for predicting PEP.Multivariate analysis revealed that a cannulation time of more than 13 min [odds ratio(OR) 2.28,95%CI:1.132-4.651,P=0.0210] and 2 h amylase levels greater than the cutoff level(OR=24.1,95%CI:11.56-57.13,P<0.0001) were significant predictive factors for PEP.Forty-seven of the 55 patients who developed PEP exhibited 2 h amylase levels greater than the cutoff level(85%),and six of the remaining eight patients who developed PEP(75%) required longer cannulation times.Only 2 of the 1403 patients(0.14%) who developed PEP did not exhibit concerning 2 h amylase levels or require longer cannulation times.CONCLUSION These findings indicate that the combination of 2 h post-ERCP serum amylase levels and cannulation times represents a valuable marker for identifying patients at high risk for PEP.展开更多
AIM:To investigate the value of elevated drain amylase concentrations for detecting anastomotic leakage(AL) after minimally invasive Ivor-Lewis esophagectomy(MIILE).METHODS:This was a retrospective analysis of prospec...AIM:To investigate the value of elevated drain amylase concentrations for detecting anastomotic leakage(AL) after minimally invasive Ivor-Lewis esophagectomy(MIILE).METHODS:This was a retrospective analysis of prospectively collected data in two hospitals in the Netherlands. Consecutive patients undergoing MI-ILE were included. A Jackson-Pratt drain next to the dorsal side of the anastomosis and bilateral chest drains were placed at the end of the thoracoscopic procedure. Amylase levels in drain fluid were determined in all patients during at least the first four postoperative days. Contrast computed tomography scans and/or endoscopic imaging were performed in cases of a clinically suspected AL. Anastomotic leakage was defined as any sign of leakage of the esophago-gastric anastomosis on endoscopy,re-operation,radiographic investigations,post mortal examination or when gastro-intestinal contents were found in drain fluid. Receiver operator characteristic curves were used to determine the cut-off values. Sensitivity,specificity,positive predictive value,negative predictive value,risk ratio and overall test accuracy were calculated for elevated drain amylase concentrations.RESULTS:A t o t a l o f 8 9 p a t ie n t s w e re in c lu d e d between March 2013 and August 2014. No differences in group characteristics were observed between patients with and without AL,except for age. Patients with AL were older than were patients without AL(P = 0.01). One patient(1.1%) without AL died within 30 d after surgery due to pneumonia and acute respiratory distress syndrome. Anastomotic leakage that required any intervention occurred in 15 patients(16.9%). Patients with proven anastomotic leakage had higher drain amylase levels than patients without anastomotic leakage [median 384 IU/L(IQR 34-6263) vs median 37 IU/L(IQR 26-66),P = 0.003]. Optimal cut-off values on postoperative days 1,2,and 3 were 350 IU/L,200 IU/L and 160 IU/L,respectively. An elevated amylase level was found in 9 of the 15 patients with AL. Five of these 9 patients had early elevations of their amylase levels,with a median of 2 d(IQR 2-5) before signs and symptoms occurred.CONCLUSION:Measurement of drain amylase levels is an inexpensive and easy tool that may be used to screen for anastomotic leakage soon after MI-ILE. However,clinical validation of this marker is necessary.展开更多
A novel mesophilic bacterial amylase, named oligosaccharide-producing multifunctional amylase(OPMA), was discovered and characterized. OPMA is an extracellular enzyme secreted by ZW253 1-1, a strain newly isolated f...A novel mesophilic bacterial amylase, named oligosaccharide-producing multifunctional amylase(OPMA), was discovered and characterized. OPMA is an extracellular enzyme secreted by ZW253 1-1, a strain newly isolated from Chinese soil. It could be purified to homogeneity from the culture supernatant of ZW2531-1 by 30%-60% saturated ammonium sulfate precipitation, followed by twice Sephadex gel filtration chromatography. OPMA is a 66 kDa protein based on SDS-PAGE and has an isoelectric point(p/) at pH=5.3 by Isoelectric focusing electrophoresis(WE). It only catalyzes the degradation of starch, rather than other alpha-l,4- and/or 1,6-glucan polysaccbarides such as fl-cyclomaltodextrin and pullulan. OPMA degraded starch to produce several oligosccharides including maltose, maltotriose, and isomaltotriose as the major end-products, and perhaps other oligosaccharides such as isomalto- tetraose, rather than glucose. OPMA exhibited optimal catalytic activity at a reaction temperature of 50 ℃ and pH=6.0, as determined by orthogonal test. Under the optimal reaction conditions, purified OPMA bad a specific activity of 13.75 U/rag. These findings suggest that OPMA could be used for the production of some oligosaccharides beneficial to the food industry and medicine.展开更多
Many studies investigating postoperative pancreatic fistula(POPF)after gastrectomy,including studies measuring drain amylase content(D-AMY)as a predictive factor have been reported.This article reviews previous studie...Many studies investigating postoperative pancreatic fistula(POPF)after gastrectomy,including studies measuring drain amylase content(D-AMY)as a predictive factor have been reported.This article reviews previous studies and looks to the future of measuring D-AMY in patients after gastrectomy.The causes of pancreatic fluid leakage are;the parenchymal and/or thermal injury to the pancreas,and blunt injury to the pancreas by compression and retraction.Measurement of D-AMY to predict POPF has become common in clinical practice after pancreatic surgery and was later extended to the gastric surgery.Several studies have reported associations between D-AMY and POPF after gastrectomy,and the high value of D-AMY on postoperative day(POD)1 was an independent risk factor.To improve both sensitivity and specificity,attempts have been made to enhance the predictive accuracy of factors on POD 1 as well as on POD 3 as combined markers.Although several studies have shown a high predictive ability of POPF,it has not necessarily been exploited in clinical practice.Many problems remain unresolved;ideal timing for measurement,optimal cut-off value,and means of intervention after prediction.Prospective clinical trial could be imperative in order to develop D-AMY measurement in common clinical practice for gastric surgery.展开更多
This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
An α-amylase encoding gene was amplified by polymerase chain reaction from Saccharomycopsis fibuligeru and inserted into a shuttle vector YEp352,together with the yeast phosphoglycerate kinase 1 prumoter and a-factor...An α-amylase encoding gene was amplified by polymerase chain reaction from Saccharomycopsis fibuligeru and inserted into a shuttle vector YEp352,together with the yeast phosphoglycerate kinase 1 prumoter and a-factor signal gene. The recombinant expression plasmid pLA8α was transformed into an industrial strain of Saccharomycopsis cerevisiae Sc-11. The activity of the α-amylase produced by the transformant Sc-11-pLA8α was 6.3 U/mL and the starch utilization rate in YPS medium was 42%. The purified amylase was analyzed by SDS-PAGE,showing a molecular weight of 55×10^3 protein band. Furthermore, the residual sugar, ethanol and some volatile compounds in the fermented worts under simulating brewing conditions were determined by chromatographic analyses. The fermentation characteristics of Sc-ll-pLA8α were similar to that of Sc-ll and only minor changes in the concentration of flavor compounds could be observed.展开更多
BACKGROUND Hypothyroidism is an endocrine disorder that has worldwide prevalence and can affect multiple organ systems.We report a case of hypothyroidism with elevated pancreatic amylase and trypsin without acute panc...BACKGROUND Hypothyroidism is an endocrine disorder that has worldwide prevalence and can affect multiple organ systems.We report a case of hypothyroidism with elevated pancreatic amylase and trypsin without acute pancreatitis.No such case has been previously reported.CASE SUMMARY A 29-year-old woman did not pay much attention to a fever 4 d prior.During this time,she experienced anorexia and only drank a small amount of water every day.She did not present with abdominal distension,postprandial nausea,vomiting,cough or expectoration.After physical and laboratory examinations,the patient was diagnosed with hypothyroidism.During the course of the disease,hypothyroidism was generally accompanied by constantly increased pancreatic amylase and trypsin.After admission,the possible etiology of the patient was excluded and the concentrations of pancreatic lipase and amylase in serum were>2000U/L(reference range 23-300 U/L)and 410 U/L(reference range 30-110 U/L),respectively.So we highly suspected that it may be acute pancreatitis.Interestingly,she never developed any complications associated with acute pancreatitis despite high levels of serum pancreatic amylase and trypsin,and she reported no symptoms of abdominal pain.Serum amylase and lipase decreased gradually after active thyroxine supplementation,and the patient was discharged from the hospital after active treatment.CONCLUSION This case suggests that clinicians should pay attention to hypothyroidism with elevated pancreatic amylase and trypsin,even if no complications of acute pancreatitis are reported.展开更多
Based on the different hydrophobicities of the intermediates of proteins the various conformational intermediates of the refolding of a-amylase originally denatured with 8.0 mol/L urea solution were separated with hi...Based on the different hydrophobicities of the intermediates of proteins the various conformational intermediates of the refolding of a-amylase originally denatured with 8.0 mol/L urea solution were separated with high performance hydrophobic interaction chromatography(HPHIC). Compared to the separation of the same intermediates with weak anion exchange chromatography and size-exclusion chromatography the result obtained with HPHIC is the best It would be expected that HPHIC may be a strongly potential tool to separate intermediates of some proteins which cannot be, or cannot completely be refolded by HPHIC.展开更多
Objective The present study aimed to test whether exposure to radiofrequency electromagnetic fields (RF-EMF) emitted by mobile phone base stations may have effects on salivary alpha-amylase, immunoglobulin A (IgA)...Objective The present study aimed to test whether exposure to radiofrequency electromagnetic fields (RF-EMF) emitted by mobile phone base stations may have effects on salivary alpha-amylase, immunoglobulin A (IgA), and cortisol levels. Methods Fifty seven participants were randomly allocated to one of three different experimental scenarios (22 participants to scenario 1, 26 to scenario 2, and 9 to scenario 3). Each participant went through five 50-minute exposure sessions. The main RF-EMF source was a GSM-900-MHz antenna located at the outer wall of the building. In scenarios 1 and 2, the first, third, and fifth sessions were "low" (median power flux density 5.2 μW/m^2) exposure. The second session was "high" (2126.8 μW/m^2), and the fourth session was "medium" (153.6 μW/m^2) in scenario 1, and vice versa in scenario 2. Scenario 3 had four "low" exposure conditions, followed by a "high" exposure condition. Biomedical parameters were collected by saliva samples three times a session. Exposure levels were created by shielding curtains. Results In scenario 3 from session 4 to session 5 (from "low" to "high" exposure), an increase of cortisol was detected, while in scenarios 1 and 2, a higher concentration of alpha-amylase related to the baseline was identified as compared to that in scenario 3. IgA concentration was not significantly related to the exposure. Conclusions RF-EMF in considerably lower field densities than ICNIRP-gnidelines may influence certain psychobiological stress markers.展开更多
The activity of α amylase from porcine pancreas was enhanced under the treatment by Ce 3+ of low concentration (0.5~10 μmol·L -1 ), but was inhibited by Ce 3+ of high concentration (>10 μmol...The activity of α amylase from porcine pancreas was enhanced under the treatment by Ce 3+ of low concentration (0.5~10 μmol·L -1 ), but was inhibited by Ce 3+ of high concentration (>10 μmol·L -1 ). Ce 3+ at high concentration displaced Ca 2+ from α amylase competitively. The equilibrium dialysis demonstrates that α amylase has five Ca 2+ binding sites with different affinities. The fluorescence titration shows that Ce 3+ can bind to Ca 2+ binding sites.展开更多
Primers and probes were established according to the sequences of the alpha-amylase genes of Bacillus. halodurans C-125, Therrnus sp. IM6501, B. stearothermophilus ET-1, and B, acidopullulytics. Primers were designed ...Primers and probes were established according to the sequences of the alpha-amylase genes of Bacillus. halodurans C-125, Therrnus sp. IM6501, B. stearothermophilus ET-1, and B, acidopullulytics. Primers were designed and a 0.2 kb DNA fragment was amplified, the fragment was successfully used for the detection of the amylase Ⅱ gene in a 2 842 bp region from Bacillus halodurans strain 38C1-1.展开更多
In order to obtain pure enzyme with high activity,two amylase producing strains were isolated from soil samples,and named as the strains LZ-10 and LZ-11.According to morphologic observation,physiology and biochemistry...In order to obtain pure enzyme with high activity,two amylase producing strains were isolated from soil samples,and named as the strains LZ-10 and LZ-11.According to morphologic observation,physiology and biochemistry experiments,16S rRNA and gyrB gene analysis,the strains LZ-10 and LZ-11 were identified as Bacillus subtilis.Adopted the method of ammonium sulfate,DEAE-52 anion purify enzyme,finally used polyacrylamide gel electrophoresis(SDS-PAGE)to detect molecular weight.The strain LZ-10 had an amylase activity of 123.3 U·mL^(-1),a purification factor of 6.8,a recovery rate of 69.5% and an optimal temperature of 50℃.The amylase activity of the strain LZ-11 was 59.91 U·mL^(-1),the purification factor was 4.5,the recovery rate was 60.5%,and the optimum temperature was 55℃.The commodity enzyme derived from Bacillus subtilis was 37.5 U·mL^(-1).The relative molecular weight of amylase activity from the two strains was 55 ku.Both thermal stability and pH stability were higher than those of commercialized amylase.展开更多
基金supported by the System for Poultry Production Technology,Beijing Innovation Research Team of Modern Agriculture(BAIC04–2016)
文摘Background: The effect of amylases combined with exogenous carbohydrase and protease in a newly harvested corn diet on starch digestibility, intestine health and cecal microbiota was investigated in broiler chickens.Methods: Two hunderd and eighty-eight 5-day-old female chickens were randomly divided into six treatments: a newly harvested corn-soybean meal diet(control); control supplemented with 1,500 U/g α-amylase(Enzyme A);Enzyme A + 300 U/g amylopectase + 20,000 U/g glucoamylase(Enzyme B); Enzyme B + protease 10,000 U/g(Enzyme C); Enzyme C + xylanase 15,000 U/g(Enzyme D); and Enzyme D + cellulase 200 U/g + pectinase 1,000 U/g(Enzyme E). Growth performance, starch digestibility, digestive organ morphology, and intestinal microbiota were evaluated in the birds at 16 and 23 d of age.Results: Compared with the control diet, supplementation with Enzyme A significantly decreased ileum lesion scoring at 16 d of age(P < 0.05); supplementation with Enzyme B or Enzyme C showed positive effects on ileal amylopectin and total starch digestibility(P < 0.05); Broilers fed with a diet supplemented with Enzyme D had a tendency to decrease body weight gain at 23 d. Enzyme E supplementation improved lesion scoring of jejunum and ileum at 16 d(P < 0.05), and increased ileal amylopectin or total starch digestibility at 23 d(P < 0.05).Supplementation of enzymes changed cecal microbiota diversity. High numbers of Campylobacter, Helicobacter and Butyricicoccus, Anaerostipes and Bifidobacterium, Sutterella and Odoribacter were the main genera detected in supplementations with Enzymes B, C, D, and E respectively.Conclusions: Supplementation with amylase combined with glucoamylase or protease showed a beneficial effect on starch digestibility and intestinal microbiota diversity, and increased growth of broilers fed with newly harvested corn.
文摘The changes in the activity of amylase and amylase-isoenzyme and the degradation of starch and pigment of tobacco leaf during flue-curing were studied by using the electric- heated flue-curing barn designed and made by the Henan Agricultural University. The temperature and humidity of the barn were controlled automatically. The results indicated that starch in tobacco leaf decreased rapidly and leveled off after 48 h of curring, in the meantime, the content of soluble sugar increased accordingly and reached a peak at the stage of color-fixing. Both of them had a rapid-changing stage in the first 36 hours of yellowing. The changes of starch and soluble sugar contents had highly significant negative-correlation at 1 % level (rNC89 = -0.8962**, rYY85 = -0.9704**). The activity of amylase increased with the proceeding of curing and reached a peak after 36 hours of curing, then decreased. But the activity of amylase kept at a high level when the humidity of curing-environment was very low, even if the tobacco leaf had been dried. The rapid degradation of starch showed a significantly negative correlation with the increase of activity of amylase at 5 % level (rNC89 = -0.8495*, rYY85 = -0.7839*). The degradation of starch and pigment had the same regulation and had highly significant correlation at 1 % level (rNC89= 0.9649**, rYY85= 0.9428**). There were mainly three amylase-isoenzyme bands -A, B, C respectively, in tobacco leaf during flue curing. They were identified as α-AMY, β-AMY, R-AMY, and the activity of β-AMY was the highest. The changes in amylase activity and contents of starch and pigment were affected by the tobacco leaf moisture and environmental humidity during curing.
基金supported by the Project of National Key Basic Research and Development, China (Grant No. 2002CB410804)the Natural Science Foundation of Guizhou Province, China (Grant No. 20072058)the Foundation for Young Scholars Scientists of Guizhou University (Grant No. X060036), China.
基金a part of the project titled ’Future Marine Technology Development’ funded by the Ministry of Oceans and Fisheries, Republic of Korea
文摘Postprandial hyperglycemia is an early indication of type 2 diabetes and the target of many anti-diabetic and anti-obesity studies.α-Glucosidase and α-amylase are the crucial factors in regulating starch digestion and glucose absorption,making them key targets for many studies to treat postprandial hyperglycemia.We studied the inhibitory activities of microalgal fucoxanthin against rat-intestinalα-glucosidase and pancreaticα-amylase along with the antidiabetic eff ect to induce diff erentiation in 3T3-L1 pre-adipocytes using Oil Red-O staining.Fucoxanthin displayed strong hindrance activities towardα-amylase in a concentration-dependent manner,with an IC50 value of 0.68mmol/L,whereas weak inhibitory activity against α-glucosidase,with an IC 50 value of 4.75 mmol/L.Fucoxanthin also considerably elevated glucose oxidase activity in 3T3-L1 cells by 31.3%at 5μmol/L.During adipocyte differentiation,fucoxanthin showed lipid accumulation in 3T3-L1 cells with no cytotoxicity up to 20μmol/L.However,fucoxanthin had no inhibitory activity on glucose-6-phosphate dehydrogenase.These results suggest that fucoxanthin might be useful for the prevention of obesity or diabetes by inhibiting carbohydrate-hydrolyzing enzymes and lipid accumulation and be utilized as an ingredient for a functional food or dietary supplement.
文摘For the last decade, low serum amylase(hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes(regardless of type), and metabolic syndrome, all of which appear to have a common etiology of insufficient insulin action due to insulin resistance and/or diminished insulin secretion. Some clinical studies have shown that salivary amylase may be preferentially decreased in obese individuals, whereas others have revealed that pancreatic amylase may be preferentially decreased in diabetic subjects with insulin dependence. Despite this accumulated evidence, the clinical relevance of serum, salivary, and pancreatic amylase and the underlying mechanisms have not been fully elucidated. In recent years, copy number variations(CNVs) in the salivary amylase gene(AMY1), which range more broadly than the pancreatic amylase gene(AMY2A and AMY2B), have been shown to be well correlated with salivary and serum amylase levels. In addition, low CNV of AMY1, indicating low salivary amylase, was associated with insulin resistance, obesity, low taste perception/satiety, and postprandial hyperglycemia through impaired insulin secretion at early cephalic phase. In most populations, insulin-dependent diabetes is less prevalent(minor contribution) compared with insulin-independent diabetes, and obesity is highly prevalent compared with low body weight. Therefore, obesity as a condition that elicits cardiometabolic diseases relating to insulin resistance(major contribution) may be a common determinant for low serum amylase in a general population. In this review, the novel interpretation of low serum, salivary, and pancreas amylase is discussed in terms of major contributions of obesity, diabetes, and metabolic syndrome.
文摘The marine yeast strain N13d, producing an extracellular amylase, was isolated from the deep sea sediments of the Pa-cific Ocean. This strain was identified to be Aureobasidium pullulans by 18S rRNA gene sequence analysis and routine yeast identi-fication methods. The optimal sea water medium for amylase production by this yeast strain was 1.0% peptone and 1.0% soluble starch with pH 4.0. The optimal conditions for amylase production by this yeast strain were with temperature 28 ℃, aeration rate 6 Lmin-1 and agitation speed 250 rmin-1. Under these conditions, 58.5 units of amylase activity per mg protein were produced within 56 h of fermentation.
文摘BACKGROUND: Measurement of total serum amylase (AMY) is the most widely used biochemical test for the diagnosis of acute pancreatitis, but it is commonly considered a nonspecific marker. To improve the biochemical diagnosis of acute pancreatitis, lipase ( LIP ) and pancreatic amylase (PAMY) have been tested in recent years. The present study was designed to evaluate whether serum LIP and pancreatic PAMY tests could replace total amylase test to improve diagnostic efficiency in the evaluation of acute pancreatitis in patients with hyperamylasemia. METHODS: LIP and PAMY values were determined in serum samples from 92 patients with hyperamylasemia. Reference values for each enzyme were derived from serum samples of 147 healthy subjects. The activities of LIP and PAMY in patients with various diseases were shown directly by the boxplot graph. The diagnostic accuracy of LIP and PAMY was defined as the area under the receiver operating characteristic (ROC) curve. Their sensitivity and specificity in detecting acute pancreatitis at varying cutoff points were shown by the curve, and the best cutoff value for each enzyme was shown by the modified ROC curve. The diagnostic values of LIP, PAMY and LIP + AMY with each upper limit of reference range (ULR) were compared with the corresponding best cutoff values. RESULTS: The references values of LIP and PAMY were 12.2-47.6 U/L and 28-95 U/L, respectively. These values in patients with acute pancreatitis were higher than those patients with other diseases. The areas under the ROC curve ( AUC) of LIP and PAMY were 0. 799 and 0. 792, respectively, With the best diagnostic cutoff point of maximum (sensitivity + specificity) -100%, we obtained values of 97.9 U/L(LIP97.9 =2. 06 × ULR) for LIP and 209 U/L (PAMY209 =2.20 ×ULR) for PAMY. The best cutoff values for LIP, PAMY and LIP +AMY demonstrated the specificity, positive predictive value, and diagnostic efficiency higher than the corresponding ULRs. CONCLUSIONS: Serum LIP and PAMY are specific for the pancreas and might replace total amylase for the diagnosis of acute pancreatitis in hyperamylasemia patients. LIP97.9 is more efficient than PAMY209 in the diagnosis of acute pancreatitis. A combined test of both enzymes is not superior to single test of either enzyme in diagnostic accuracy.
文摘AIM To estimate the efficacy of 2 h post-endoscopic retrograde cholangiopancreatography(ERCP) serum amylase levels and other factors for predicting postERCP pancreatitis.METHODS This was a retrospective,single-center cohort study of consecutive patients who underwent ERCP from January 2010 to December 2013.Serum amylase levels were measured 2 h post-procedure,and patient- and procedure-related pancreatitis(PEP) risk factors wereanalyzed using a logistic model.RESULTS A total of 1520 cases(average age 72 ± 12 years,60% male) were initially enrolled in this study,and 1403 cases(725 patients) were ultimately analyzed after the exclusion of 117 cases.Fifty-five of these cases developed PEP.We established a 2 h serum amylase cutoff level of two times the upper limit of normal for predicting PEP.Multivariate analysis revealed that a cannulation time of more than 13 min [odds ratio(OR) 2.28,95%CI:1.132-4.651,P=0.0210] and 2 h amylase levels greater than the cutoff level(OR=24.1,95%CI:11.56-57.13,P<0.0001) were significant predictive factors for PEP.Forty-seven of the 55 patients who developed PEP exhibited 2 h amylase levels greater than the cutoff level(85%),and six of the remaining eight patients who developed PEP(75%) required longer cannulation times.Only 2 of the 1403 patients(0.14%) who developed PEP did not exhibit concerning 2 h amylase levels or require longer cannulation times.CONCLUSION These findings indicate that the combination of 2 h post-ERCP serum amylase levels and cannulation times represents a valuable marker for identifying patients at high risk for PEP.
文摘AIM:To investigate the value of elevated drain amylase concentrations for detecting anastomotic leakage(AL) after minimally invasive Ivor-Lewis esophagectomy(MIILE).METHODS:This was a retrospective analysis of prospectively collected data in two hospitals in the Netherlands. Consecutive patients undergoing MI-ILE were included. A Jackson-Pratt drain next to the dorsal side of the anastomosis and bilateral chest drains were placed at the end of the thoracoscopic procedure. Amylase levels in drain fluid were determined in all patients during at least the first four postoperative days. Contrast computed tomography scans and/or endoscopic imaging were performed in cases of a clinically suspected AL. Anastomotic leakage was defined as any sign of leakage of the esophago-gastric anastomosis on endoscopy,re-operation,radiographic investigations,post mortal examination or when gastro-intestinal contents were found in drain fluid. Receiver operator characteristic curves were used to determine the cut-off values. Sensitivity,specificity,positive predictive value,negative predictive value,risk ratio and overall test accuracy were calculated for elevated drain amylase concentrations.RESULTS:A t o t a l o f 8 9 p a t ie n t s w e re in c lu d e d between March 2013 and August 2014. No differences in group characteristics were observed between patients with and without AL,except for age. Patients with AL were older than were patients without AL(P = 0.01). One patient(1.1%) without AL died within 30 d after surgery due to pneumonia and acute respiratory distress syndrome. Anastomotic leakage that required any intervention occurred in 15 patients(16.9%). Patients with proven anastomotic leakage had higher drain amylase levels than patients without anastomotic leakage [median 384 IU/L(IQR 34-6263) vs median 37 IU/L(IQR 26-66),P = 0.003]. Optimal cut-off values on postoperative days 1,2,and 3 were 350 IU/L,200 IU/L and 160 IU/L,respectively. An elevated amylase level was found in 9 of the 15 patients with AL. Five of these 9 patients had early elevations of their amylase levels,with a median of 2 d(IQR 2-5) before signs and symptoms occurred.CONCLUSION:Measurement of drain amylase levels is an inexpensive and easy tool that may be used to screen for anastomotic leakage soon after MI-ILE. However,clinical validation of this marker is necessary.
基金Supported by the National High Technology Research and Development Program of China(No.2007AA100601-2)the National Natural Science Foundation of China(No.30870518).
文摘A novel mesophilic bacterial amylase, named oligosaccharide-producing multifunctional amylase(OPMA), was discovered and characterized. OPMA is an extracellular enzyme secreted by ZW253 1-1, a strain newly isolated from Chinese soil. It could be purified to homogeneity from the culture supernatant of ZW2531-1 by 30%-60% saturated ammonium sulfate precipitation, followed by twice Sephadex gel filtration chromatography. OPMA is a 66 kDa protein based on SDS-PAGE and has an isoelectric point(p/) at pH=5.3 by Isoelectric focusing electrophoresis(WE). It only catalyzes the degradation of starch, rather than other alpha-l,4- and/or 1,6-glucan polysaccbarides such as fl-cyclomaltodextrin and pullulan. OPMA degraded starch to produce several oligosccharides including maltose, maltotriose, and isomaltotriose as the major end-products, and perhaps other oligosaccharides such as isomalto- tetraose, rather than glucose. OPMA exhibited optimal catalytic activity at a reaction temperature of 50 ℃ and pH=6.0, as determined by orthogonal test. Under the optimal reaction conditions, purified OPMA bad a specific activity of 13.75 U/rag. These findings suggest that OPMA could be used for the production of some oligosaccharides beneficial to the food industry and medicine.
基金We are grateful to the nonprofit organization Epidemiological and Clinical Research Information Network(ECRIN)for providing their valuable support with this work.
文摘Many studies investigating postoperative pancreatic fistula(POPF)after gastrectomy,including studies measuring drain amylase content(D-AMY)as a predictive factor have been reported.This article reviews previous studies and looks to the future of measuring D-AMY in patients after gastrectomy.The causes of pancreatic fluid leakage are;the parenchymal and/or thermal injury to the pancreas,and blunt injury to the pancreas by compression and retraction.Measurement of D-AMY to predict POPF has become common in clinical practice after pancreatic surgery and was later extended to the gastric surgery.Several studies have reported associations between D-AMY and POPF after gastrectomy,and the high value of D-AMY on postoperative day(POD)1 was an independent risk factor.To improve both sensitivity and specificity,attempts have been made to enhance the predictive accuracy of factors on POD 1 as well as on POD 3 as combined markers.Although several studies have shown a high predictive ability of POPF,it has not necessarily been exploited in clinical practice.Many problems remain unresolved;ideal timing for measurement,optimal cut-off value,and means of intervention after prediction.Prospective clinical trial could be imperative in order to develop D-AMY measurement in common clinical practice for gastric surgery.
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
基金Supported bythe National Tenth Five-Year Hi-Technique Project(2001BA708B05-04)
文摘An α-amylase encoding gene was amplified by polymerase chain reaction from Saccharomycopsis fibuligeru and inserted into a shuttle vector YEp352,together with the yeast phosphoglycerate kinase 1 prumoter and a-factor signal gene. The recombinant expression plasmid pLA8α was transformed into an industrial strain of Saccharomycopsis cerevisiae Sc-11. The activity of the α-amylase produced by the transformant Sc-11-pLA8α was 6.3 U/mL and the starch utilization rate in YPS medium was 42%. The purified amylase was analyzed by SDS-PAGE,showing a molecular weight of 55×10^3 protein band. Furthermore, the residual sugar, ethanol and some volatile compounds in the fermented worts under simulating brewing conditions were determined by chromatographic analyses. The fermentation characteristics of Sc-ll-pLA8α were similar to that of Sc-ll and only minor changes in the concentration of flavor compounds could be observed.
基金Supported by Shanghai Shenkang Hospital Development Center,No.SHDC12016109.
文摘BACKGROUND Hypothyroidism is an endocrine disorder that has worldwide prevalence and can affect multiple organ systems.We report a case of hypothyroidism with elevated pancreatic amylase and trypsin without acute pancreatitis.No such case has been previously reported.CASE SUMMARY A 29-year-old woman did not pay much attention to a fever 4 d prior.During this time,she experienced anorexia and only drank a small amount of water every day.She did not present with abdominal distension,postprandial nausea,vomiting,cough or expectoration.After physical and laboratory examinations,the patient was diagnosed with hypothyroidism.During the course of the disease,hypothyroidism was generally accompanied by constantly increased pancreatic amylase and trypsin.After admission,the possible etiology of the patient was excluded and the concentrations of pancreatic lipase and amylase in serum were>2000U/L(reference range 23-300 U/L)and 410 U/L(reference range 30-110 U/L),respectively.So we highly suspected that it may be acute pancreatitis.Interestingly,she never developed any complications associated with acute pancreatitis despite high levels of serum pancreatic amylase and trypsin,and she reported no symptoms of abdominal pain.Serum amylase and lipase decreased gradually after active thyroxine supplementation,and the patient was discharged from the hospital after active treatment.CONCLUSION This case suggests that clinicians should pay attention to hypothyroidism with elevated pancreatic amylase and trypsin,even if no complications of acute pancreatitis are reported.
文摘Based on the different hydrophobicities of the intermediates of proteins the various conformational intermediates of the refolding of a-amylase originally denatured with 8.0 mol/L urea solution were separated with high performance hydrophobic interaction chromatography(HPHIC). Compared to the separation of the same intermediates with weak anion exchange chromatography and size-exclusion chromatography the result obtained with HPHIC is the best It would be expected that HPHIC may be a strongly potential tool to separate intermediates of some proteins which cannot be, or cannot completely be refolded by HPHIC.
基金funded by the Land Salzburg Federal Government,Science Department,and Mr.Daniell Porsche,Chairman of the Paracelsus-School at St.Jakob am Thurn,Salzburg,Austria.
文摘Objective The present study aimed to test whether exposure to radiofrequency electromagnetic fields (RF-EMF) emitted by mobile phone base stations may have effects on salivary alpha-amylase, immunoglobulin A (IgA), and cortisol levels. Methods Fifty seven participants were randomly allocated to one of three different experimental scenarios (22 participants to scenario 1, 26 to scenario 2, and 9 to scenario 3). Each participant went through five 50-minute exposure sessions. The main RF-EMF source was a GSM-900-MHz antenna located at the outer wall of the building. In scenarios 1 and 2, the first, third, and fifth sessions were "low" (median power flux density 5.2 μW/m^2) exposure. The second session was "high" (2126.8 μW/m^2), and the fourth session was "medium" (153.6 μW/m^2) in scenario 1, and vice versa in scenario 2. Scenario 3 had four "low" exposure conditions, followed by a "high" exposure condition. Biomedical parameters were collected by saliva samples three times a session. Exposure levels were created by shielding curtains. Results In scenario 3 from session 4 to session 5 (from "low" to "high" exposure), an increase of cortisol was detected, while in scenarios 1 and 2, a higher concentration of alpha-amylase related to the baseline was identified as compared to that in scenario 3. IgA concentration was not significantly related to the exposure. Conclusions RF-EMF in considerably lower field densities than ICNIRP-gnidelines may influence certain psychobiological stress markers.
文摘The activity of α amylase from porcine pancreas was enhanced under the treatment by Ce 3+ of low concentration (0.5~10 μmol·L -1 ), but was inhibited by Ce 3+ of high concentration (>10 μmol·L -1 ). Ce 3+ at high concentration displaced Ca 2+ from α amylase competitively. The equilibrium dialysis demonstrates that α amylase has five Ca 2+ binding sites with different affinities. The fluorescence titration shows that Ce 3+ can bind to Ca 2+ binding sites.
基金Natural Science Foundation of Heilongjiang Province (C9912)
文摘Primers and probes were established according to the sequences of the alpha-amylase genes of Bacillus. halodurans C-125, Therrnus sp. IM6501, B. stearothermophilus ET-1, and B, acidopullulytics. Primers were designed and a 0.2 kb DNA fragment was amplified, the fragment was successfully used for the detection of the amylase Ⅱ gene in a 2 842 bp region from Bacillus halodurans strain 38C1-1.
基金Supported by Young Doctor Fund of Gansu Education Department,China(2021QB-034)。
文摘In order to obtain pure enzyme with high activity,two amylase producing strains were isolated from soil samples,and named as the strains LZ-10 and LZ-11.According to morphologic observation,physiology and biochemistry experiments,16S rRNA and gyrB gene analysis,the strains LZ-10 and LZ-11 were identified as Bacillus subtilis.Adopted the method of ammonium sulfate,DEAE-52 anion purify enzyme,finally used polyacrylamide gel electrophoresis(SDS-PAGE)to detect molecular weight.The strain LZ-10 had an amylase activity of 123.3 U·mL^(-1),a purification factor of 6.8,a recovery rate of 69.5% and an optimal temperature of 50℃.The amylase activity of the strain LZ-11 was 59.91 U·mL^(-1),the purification factor was 4.5,the recovery rate was 60.5%,and the optimum temperature was 55℃.The commodity enzyme derived from Bacillus subtilis was 37.5 U·mL^(-1).The relative molecular weight of amylase activity from the two strains was 55 ku.Both thermal stability and pH stability were higher than those of commercialized amylase.