[Objectives]This study was conducted to effectively monitor PGR residues in bean sprouts to provide guarantee for the food safety of agricultural products.[Methods]A high-performance liquid chromatography-tandem mass ...[Objectives]This study was conducted to effectively monitor PGR residues in bean sprouts to provide guarantee for the food safety of agricultural products.[Methods]A high-performance liquid chromatography-tandem mass spectrometry(HPLC-MS/MS)method for the determination of residues of 15 plant growth regulators(PGRs)in bean sprouts was established using bean sprouts as an experimental material.Samples were extracted with a solution containing 5%acetic acid-acetonitrile(1∶99,V/V),purified with anhydrous magnesium sulfate,and diluted with methanol solvent to constant volume.The solutions were filtered through 0.22μm filtering membrane and the target analytes were separated on a Phenomenex H18 column.The identification of each compound was established by retention time matching along with the accurate mass measurement of the precursor ions and their main fragment ions.The quantification was carried out using matrix-matched external standard method.[Results]The retention time of the 15 PGRs were found in the range from 5.8-11.7 min under the optimized conditions.The linear relation was good in the concentration range of 0.005-0.050μg/ml,and the correlation coefficients of the 15 PGRs were≥0.9990.The limits of detection were in the range of 0.03-0.92 g/kg,and the limits of quantification were in the range of 0.50-2.10μg/kg.The average recovery in the recovery test at 3 concentration levels was 80%-110%,and the relative standard deviations were in the range of 2.8%-7.5%.[Conclusions]This method is simple and accurate,and can quickly qualitatively and quantitatively analyze the residues of 15 PGRs in bean sprouts.The proposed procedure was simple,quick and accurate for the simultaneous determination of the 15 PGRs in bean sprout.展开更多
Mung bean(Vigna radiata)sprouts are widely consumed worldwide due to their high nutritional value.However,the low yield and microbial contamination of mung bean sprouts seriously reduces their economic value.This stud...Mung bean(Vigna radiata)sprouts are widely consumed worldwide due to their high nutritional value.However,the low yield and microbial contamination of mung bean sprouts seriously reduces their economic value.This study investigates the effects of non-thermal plasma on the quality and microbial reduction of mung bean sprouts by pretreatment of seeds in water for different times(0,1,3 and 6 min).The quality results showed that short-time plasma treatment(1 and 3 min)promoted seed germination and seedling growth,whereas long-time plasma treatment(6 min)had inhibitory effects.Plasma also had a similar dose effects on the total flavonoid and phenolic contents of mung bean sprouts.The microbiological results showed that plasma treatment achieved a reduction of native microorganisms ranging from 0.54 to 7.09 log for fungi and 0.29 to 6.80 log for bacteria at 96 h incubation.Meanwhile,plasma treatment could also efficiently inactivate artificially inoculated Salmonella typhimurium(1.83–6.22 log)and yeast(0.53–3.19 log)on mung bean seeds.The results of seed coat permeability tests and scanning electron microscopy showed that plasma could damage the seed coat structure,consequently increasing the electrical conductivity of mung bean seeds.The physicochemical analysis of plasma-treated water showed that plasma generated various long-and short-lived active species[nitric oxide radicals(NO·),hydroxyl radicals(·OH),singlet oxygen(1O2),hydrogen peroxide(H_(2)O_(2)),nitrate(NO_(3)^(-)),and nitrite(NO_(2)^(-))]in water,thus the oxidizability,acidity and conductivity of plasma-treated water were all increased in a treatment timedependent manner.The result for mimicked chemical mixtures confirmed the synergistic effect of activity of H_(2)O_(2),NO_(3)^(-)and NO_(2)^(-)on bacterial inactivation and plant growth promotion.Taken together,these results imply that plasma pretreatment of mung bean seeds in water with moderate oxidizability and acidity is an effective method to improve the yield of mung bean sprouts and reduce microbial contamination.展开更多
This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
基金Supported by Research Projects Funded by Talent Project Training Funds in Hebei Province(A201901128)Key R&D Project of Tangshan City(20150210C).
文摘[Objectives]This study was conducted to effectively monitor PGR residues in bean sprouts to provide guarantee for the food safety of agricultural products.[Methods]A high-performance liquid chromatography-tandem mass spectrometry(HPLC-MS/MS)method for the determination of residues of 15 plant growth regulators(PGRs)in bean sprouts was established using bean sprouts as an experimental material.Samples were extracted with a solution containing 5%acetic acid-acetonitrile(1∶99,V/V),purified with anhydrous magnesium sulfate,and diluted with methanol solvent to constant volume.The solutions were filtered through 0.22μm filtering membrane and the target analytes were separated on a Phenomenex H18 column.The identification of each compound was established by retention time matching along with the accurate mass measurement of the precursor ions and their main fragment ions.The quantification was carried out using matrix-matched external standard method.[Results]The retention time of the 15 PGRs were found in the range from 5.8-11.7 min under the optimized conditions.The linear relation was good in the concentration range of 0.005-0.050μg/ml,and the correlation coefficients of the 15 PGRs were≥0.9990.The limits of detection were in the range of 0.03-0.92 g/kg,and the limits of quantification were in the range of 0.50-2.10μg/kg.The average recovery in the recovery test at 3 concentration levels was 80%-110%,and the relative standard deviations were in the range of 2.8%-7.5%.[Conclusions]This method is simple and accurate,and can quickly qualitatively and quantitatively analyze the residues of 15 PGRs in bean sprouts.The proposed procedure was simple,quick and accurate for the simultaneous determination of the 15 PGRs in bean sprout.
基金supported by National Natural Science Foundation of China(Nos.11605159 and 11405147)Chinese Postdoctoral Science Foundation(No.2017M612412)+3 种基金the Foundation of Key Technology Research Project of Henan Province(No.182102311115)Key Discipline Construction Project of Zhengzhou University(No.32410257)Youth Innovation Project of Key Discipline of Zhengzhou University(No.XKZDQN202002)Natural Science Foundation of Henan Province(No.202300410013)。
文摘Mung bean(Vigna radiata)sprouts are widely consumed worldwide due to their high nutritional value.However,the low yield and microbial contamination of mung bean sprouts seriously reduces their economic value.This study investigates the effects of non-thermal plasma on the quality and microbial reduction of mung bean sprouts by pretreatment of seeds in water for different times(0,1,3 and 6 min).The quality results showed that short-time plasma treatment(1 and 3 min)promoted seed germination and seedling growth,whereas long-time plasma treatment(6 min)had inhibitory effects.Plasma also had a similar dose effects on the total flavonoid and phenolic contents of mung bean sprouts.The microbiological results showed that plasma treatment achieved a reduction of native microorganisms ranging from 0.54 to 7.09 log for fungi and 0.29 to 6.80 log for bacteria at 96 h incubation.Meanwhile,plasma treatment could also efficiently inactivate artificially inoculated Salmonella typhimurium(1.83–6.22 log)and yeast(0.53–3.19 log)on mung bean seeds.The results of seed coat permeability tests and scanning electron microscopy showed that plasma could damage the seed coat structure,consequently increasing the electrical conductivity of mung bean seeds.The physicochemical analysis of plasma-treated water showed that plasma generated various long-and short-lived active species[nitric oxide radicals(NO·),hydroxyl radicals(·OH),singlet oxygen(1O2),hydrogen peroxide(H_(2)O_(2)),nitrate(NO_(3)^(-)),and nitrite(NO_(2)^(-))]in water,thus the oxidizability,acidity and conductivity of plasma-treated water were all increased in a treatment timedependent manner.The result for mimicked chemical mixtures confirmed the synergistic effect of activity of H_(2)O_(2),NO_(3)^(-)and NO_(2)^(-)on bacterial inactivation and plant growth promotion.Taken together,these results imply that plasma pretreatment of mung bean seeds in water with moderate oxidizability and acidity is an effective method to improve the yield of mung bean sprouts and reduce microbial contamination.
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
