Successful Treatment with Triple Therapy of Amphotericin B, Voriconazole and Flucytosine on an AIDS Patients with Severe Cryptococcal Meningitis

A 35-year-old man(body weight=63 kg)with AIDS complaining fever and headache after having commenced anti-retroviral therapy(ART)for a week was admitted to our hospital.Five lumbar punctures performed during38 days could not confirm a cryptococcal meningitis(CM)based on staining or culture methods for cerebrospinal fluid(CSF).The disease quickly progressed with serious hearing/vision impairment and frequent onset of seizure and coma after being treated with corticosteroids for five days,and then CM was confirmed.Subsequent lumbar puncture showed elevated intracranial pressure as high as 870 mm H2O,even though treated with standard antifungal regimens for CM.His disease was finally controlled by a new triple therapy with amphotericin B(0.7mg?kg-1?day-1,intravenously),flucytosine(100 mg/kg perday,orally in four divided doses),and voriconazole(200mg every 12 hours)and ART containing lamivudine(300 mg/day),stavuding(30 mg,twice a day)and efavirenz(300 mg,orally every night).Although it is rare,negative CSF stain or culture for cryptococci in AIDS patients with CM can persist for a long time.Corticosteroids should be used cautiously when an effective anti-fungal therapy is not administered.Triple therapy with amphotericin B,flucytosine and voriconazole may be selectively applied in severe CM.Voriconazole can be co-administered with efavirenz with modified dosing.

Voriconazole in an infant with cryptococcal meningitis

Cryptococcus neoformans （C. neoformans） is the most common cause of fungal meningitis worldwide.1 Cryptococcal meningitis is an opportunistic infection commonly found in immunocompromised hosts, especially HIV-infected adults. It also occurs in apparently immunocompetent individuals. Rarely has it been reported in children, and it is almost nonexistent in infants. Voriconazole is a member of a second generation of antifungal triazoles with broad spectrum antifungal activity, oral and parenteral bioavailability and a favorable safety profile in adults.3 This patient shows improved in vitro activity against C. neoformans when compared to fluconazole and it has been used successfully in about half the patients with refractory cryptococcosis.4 However, the efficacy and safety of voriconazole as a antifungal agent in children with cryptococcal meningitis have not been well assessed, This report described cryptococcal meningitis in a 13-day-old premature neonate who recovered without overt toxicity after voriconazole was added to an antifungal regimen that included amphotericin B and flucytosine. We focused on the response of this child with cryptococcal meningitis to voriconazole.

A Mimic of Hepatic Encephalopathy: Two Cases of Cryptococcal Meningitis in North America

In the non-human immunodeficiency virus infected population,cryptococcosis occurs primarily in people who are functionally immunosuppressed,including patients who have undergone solid organ transplantation requiring immunosuppressive medications,are on corticosteroids,or have renal failure or cirrhosis.Cryptococcal meningitis poses a particular challenge in the setting of cirrhosis because its clinical presentation can mimic hepatic encephalopathy.Here,we describe two patients with decompensated cirrhosis,both with a known history of hepatic encephalopathy who had lumbar punctures and were found to have cryptococcal meningitis.The first patient had a subacute fluctuating change in mental status,while the second patient had progressive subacute headaches,gait disturbance,and hearing loss.Both patients were treated with amphotericin B and flucytosine induction,but only the second survived to maintenance therapy.These cases demonstrate the importance of having a high index of suspicion for cryptococcal meningitis in cirrhosis and having a low threshold for performing a lumbar puncture when altered mental status or other neurologic complaints are not fully explained by hepatic encephalopathy.We also provide a brief review of the pathobiology of cryptococcal infection in cirrhosis and highlight the challenges in therapy.

Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis

Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods:The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATTTAGAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOVA)in R software.Results:The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each<1.41%).ITS genotype was defined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P=0.0014)between infectious group and control group was observed.Conclusions:The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.

Antifungal therapy for treatment of cryptococcal meningitis

Objective To compare the curative effects of three different antifungal regimens in the treatment of cryptococcal meningitis Methods Twenty two patients were divided into 3 groups: Group Ⅰ was given intravenous amphotericin B alone or combination with flucytosine therapy Group Ⅱ received intravenous fluconazole alone or combination with flucytosine The treatment of Group Ⅲ was divided into two steps, where the patients received intrathecal amphotericin B plus intravenous amphotericin B with or without intravenous fluconazole until the mycological culture of cerebrospinal fluid (CSF) turned negative, followed by oral fluconazole or itraconazole as maintenance therapy until direct microscopic examination of CSF showed negative once a week for three consecutive weeks Results Of the twenty two patients, 17 (77 3%) were cured, 2 (9 1%) improved, 3 (13 6%) died, and one (4 5%) relapsed Of the 8 patients in Group Ⅰ, 5 were cured, 2 improved, one died and one relapsed; Of the 4 patients in Group Ⅱ, 2 were cured, and 2 died; All the 10 patients in Group Ⅲ were cured without any recurrence Conclusion The two step therapeutic regimen may be suited to the treatment of cryptococcal meningitis

Clinical features and treatment outcomes of human immunodeficiency virus-associated cryptococcal meningitis:a 2-year retrospective analysis

Background:Cryptococcal meningitis(CM)is one of the most common opportunistic infections caused by Cryptococcus neoformans in human immunodeficiency virus(HIV)-infected patients,and is complicated with significant morbidity and mortality.This study retrospectively analyzed the clinical features,characteristics,treatment,and outcomes of first-diagnosed HIV-associated CM after 2-years of follow-up.Methods:Data from all patients(n=101)of HIV-associated CM hospitalized in Shanghai Public Health Clinical Center from September 2013 to December 2016 were collected and analyzed using logistic regression to identify clinical and microbiological factors associated with mortality.Results:Of the 101 patients,86/99(86.9%)of patients had CD4 count<50 cells/mm^3,57/101(56.4%)were diagnosed at≥14 days from the onset to diagnosis,42/99(42.4%)had normal cerebrospinal fluid(CSF)cell counts and biochemical examination,30/101(29.7%)had concomitant Pneumocystis(carinii)jiroveci pneumonia(PCP)on admission and 37/92(40.2%)were complicated with cryptococcal pneumonia,50/74(67.6%)had abnormalities shown on intracranial imaging,amongst whom 24/50(48.0%)had more than one lesion.The median time to negative CSF Indian ink staining was 8.50 months(interquartile range,3.25-12.00 months).Patients who initiated antiretroviral therapy(ART)before admission had a shorter time to negative CSF Indian ink compared with ART-naïve patients(7 vs.12 months,χ^2=15.53,P<0.001).All-cause mortality at 2 weeks,8 weeks,and 2 years was 10.1%(10/99),18.9%(18/95),and 20.7%(19/92),respectively.Coinfection with PCP on admission(adjusted odds ratio[AOR],3.933;95%confidence interval[CI],1.166-13.269,P=0.027)and altered mental status(AOR,9.574;95%CI,2.548-35.974,P=0.001)were associated with higher mortality at 8 weeks.Conclusion:This study described the clinical features and outcomes of first diagnosed HIV-associated CM with 2-year follow-up data.Altered mental status and coinfection with PCP predicted mortality in HIV-associated CM.

Current diagnosis and treatment of cryptococcal meningitis without acquired immunodeficiency syndrome

Cryptococcal meningitis(CM)is a central nervous system infectious disease caused by Cryptococcus.It is the most common fungal infection in the central nervous system,accounting for about 48%of fungal infection.The disease occurs mainly in acquired immunodeficiency syndrome(AIDS)patients and concentrates in the immunocompromised people without AIDS.There are nearly one million new cases of CM each year,and about 70%of them died.In China,CM occurs mainly in people without AIDS and there is an increasing trend in recent years.Early diagnosis and treatment is the key to reducing morbidity and mortality associated with CM.The diagnosis mainly depends on laboratory examination such as morphological examination,fungal culture and antigen detection.History,clinical manifestation and imaging examination are the important parts of auxiliary examination.The initial combined antifungal treatment is emphasized,and the principle of fractional treatment including induction,consolidation and maintenance therapy should be followed.The high intracranial pressure must be reduced actively at the same time.In addition,it is proved that the novel immunotherapy combined with antifungal agents can improve the curative effect and limit the chance of antimicrobial resistance.Large-scale clinical trials are needed for further study.

Treatment of cryptococcal meningitis with low-dose amphotericin B and flucytosine

Background Amphotericin B （0.7 mg/kg） with flucytosine is the standard treatment for cryptococcal meningitis.However,the long treatment course can induce adverse reactions in patients; therefore,reducing the dose may decrease such reactions.We performed a retrospective analysis of treatment effects and adverse reactions when amphotericin B （0.4 mg/kg or 0.7 mg/kg per day） and flucytosine were used together to treat HIV-negative patients with cryptococcal meningitis.Methods Retrospective analysis was conducted on inpatients at the First Affiliated Hospital,College of Medicine,Zhejiang University （January 2005 to December 2009）.Low- or high-dose amphotericin B （0.4 or 0.7 mg/kg per day,respectively） plus flucytosine was used.The negative conversion rate of Cryptococcus in the cerebrospinal fluid （CSF）,patient mortality,and the incidence of side effects for the two groups （low- vs.high-dose） were compared immediately after treatment and 2 and 10 weeks later.Data were analyzed by the Student＇s t test,chi-square tests using SPSS 12.0 statistical soitware.Results Two weeks post-treatment,Cryptococcus negative CSF rates were 78% （18/23） in the low-dose group and 87% （13/15） in the high-dose group （P=0.28）.Ten weeks post-treatment,both groups were negative.The mortality rate was 8% （2/25） in the low-dose group and 17% （3/18） in the high-dose group （P=-0.25）.There was a statistically significant difference in the incidence of adverse events between the groups,48% （12/25） and 78% （14/18） in the low- and high-dose groups,respectively （P=0.04）.Adverse events that required a change in treatment program in the low-dose group were 12% （3/25） compared to 39% （7/18） in the high-dose group （P=-0.04）.Conclusion Low-dose treatment regimens were better tolerated

Cryptococcus neoformans,a global threat to human health

Background Emerging fungal pathogens pose important threats to global public health. The World Health Organization has responded to the rising threat of traditionally neglected fungal infections by developing a Fungal Priority Pathogens List (FPPL). Taking the highest-ranked fungal pathogen in the FPPL,Cryptococcus neoformans, as a paradigm, we review progress made over the past two decades on its global burden, its clinical manifestation and management of cryptococcal infection, and its antifungal resistance. The purpose of this review is to drive research efforts to improve future diagnoses, therapies, and interventions associated with fungal infections.Methods We first reviewed trends in the global burden of HIV-associated cryptococcal infection, mainly based on a series of systematic studies. We next conducted scoping reviews in accordance with the guidelines described in the Preferred Reporting Items for Systematic Reviews and Meta-analyses extension for Scoping Reviews using PubMed and ScienceDirect with the keywordCryptococcus neoformans to identify case reports of cryptococcal infections published since 2000. We then reviewed recent updates on the diagnosis and antifungal treatment of cryptococcal infections. Finally, we summarized knowledge regarding the resistance and tolerance ofC. neoformans to approved antifungal drugs.Results There has been a general reduction in the estimated global burden of HIV-associated cryptococcal meningitis since 2009, probably due to improvements in highly active antiretroviral therapies. However, cryptococcal meningitis still accounts for 19% of AIDS-related deaths annually. The incidences of CM in Europe and North America and the Latin America region have increased by approximately two-fold since 2009, while other regions showed either reduced or stable numbers of cases. Unfortunately, diagnostic and treatment options for cryptococcal infections are limited, and emerging antifungal resistance exacerbates the public health burden.Conclusions The rising threat ofC. neoformans is compounded by accumulating evidence for its ability to infect immunocompetent individuals and the emergence of antifungal-resistant variants. Emphasis should be placed on further understanding the mechanisms of pathogenicity and of antifungal resistance and tolerance. The development of novel management strategies through the identification of new drug targets and the discovery and optimization of new and existing diagnostics and therapeutics are key to reducing the health burden.