Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA...Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.展开更多
The composition of Pamica (PICNH2Ca2) is dsRNA polyI:C, non-biotics amino compounds and CaCl2. It is the second generation noncytotoxic product of PICKCa (PIKA) adjuvant which was found effective in phase II clinical ...The composition of Pamica (PICNH2Ca2) is dsRNA polyI:C, non-biotics amino compounds and CaCl2. It is the second generation noncytotoxic product of PICKCa (PIKA) adjuvant which was found effective in phase II clinical trial for PICKCa rabies vaccine and phase I trial for PICKCa hepatitis B vaccine in Singapore. With their knowledge and consent, cancer patients, regardless of their tumor types or performance status (ECOG above 5 or ECOG > 20), who were unresponsive to standard treatment, were treated free of charge with Pamica by injection or nasal spray. The primary results indicated that Pamica had no side effect except for a few cases of local pain in the site of injection and appeared to markedly improve cancer patients’ appetite, physical strength, quality of life and extended patients’ life for months and counting. These preliminary findings underlined promise of this potentially life-saving drug. In the hope of cooperating with the proper authorities, companies, and hospitals to benefit patients at the earliest opportunity, we share our findings in this paper.展开更多
文摘Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.
文摘The composition of Pamica (PICNH2Ca2) is dsRNA polyI:C, non-biotics amino compounds and CaCl2. It is the second generation noncytotoxic product of PICKCa (PIKA) adjuvant which was found effective in phase II clinical trial for PICKCa rabies vaccine and phase I trial for PICKCa hepatitis B vaccine in Singapore. With their knowledge and consent, cancer patients, regardless of their tumor types or performance status (ECOG above 5 or ECOG > 20), who were unresponsive to standard treatment, were treated free of charge with Pamica by injection or nasal spray. The primary results indicated that Pamica had no side effect except for a few cases of local pain in the site of injection and appeared to markedly improve cancer patients’ appetite, physical strength, quality of life and extended patients’ life for months and counting. These preliminary findings underlined promise of this potentially life-saving drug. In the hope of cooperating with the proper authorities, companies, and hospitals to benefit patients at the earliest opportunity, we share our findings in this paper.
