Proteolipid protein 1 gene sequencing of hereditary spastic paraplegia

PCR amplification and sequencing of whole blood DNA from an individual with hereditary spastic paraplegia, as well as family members, revealed a fragment of proteolipid protein 1 （PLP1） gene exon 1, which excluded the possibility of isomer 1 expression for this family. The fragment sequence of exon 3 and exon 5 was consistent with the proteolipid protein 1 sequence at NCBI. In the proband samples, a PLP1 point mutation in exon 4 was detected at the basic group of position 844, T→C, phenylalanine→leucine. In proband samples from a male cousin, the basic group at position 844 was C, but gene sequencing signals revealed mixed signals of T and C, indicating possible mutation at this locus. Results demonstrated that changes in PLP1 exon 4 amino acids were associated with onset of hereditary spastic paraplegia.

Gene sequencing technology and its applications in cancer precision medicine

In clinical oncology,gene mutation detection plays a pivotal role in precision medicine.With advances in gene sequencing technology,the cost and time of sequencing decrease and its throughput increases.Gene sequencing technology can be utilized to detect and analyze the cancer-associated genes and underlying molecular mechanism.These data will assist clinicians to prescribe rational treatment programs for patients with cancer better,ultimately improving their prognosis.This review will provide insights into gene sequencing technology and its applications in cancer precision medicine.

Mechanism of Guangdong Shenqu in regulating intestinal flora in mice with food stagnation and internal heat based on 16S rDNA sequencing Author links open overlay panel

Objective To investigate the effect of Guangdong Shenqu(GSQ)on intestinal flora structure in mice with food stagnation through 16S rDNA sequencing.Methods Mice were randomly assigned to control,model,GSQ low-dose(GSQL),GSQ medium-dose(GSQM),GSQ high-dose(GSQH),and lacidophilin tablets(LAB)groups,with each group containing 10 mice.A food stagnation and internal heat mouse model was established through intragastric administration of a mixture of beeswax and olive oil(1:15).The control group was administered normal saline,and the model group was administered beeswax and olive oil to maintain a state.The GSQL(2 g/kg),GSQM(4 g/kg),GSQH(8 g/kg),and LAB groups(0.625 g/kg)were administered corresponding drugs for 5 d.After administration,16S rDNA sequencing was performed to assess gut microbiota in mouse fecal samples.Results The model group exhibited significant intestinal flora changes.Following GSQ administration,the abundance and diversity index of the intestinal flora increased significantly,the number of bacterial species was regulated,andαandβdiversity were improved.GSQ administration increased the abundance of probiotics,including Clostridia,Lachnospirales,and Lactobacillus,whereas the abundance of conditional pathogenic bacteria,such as Allobaculum,Erysipelotrichaceae,and Bacteroides decreased.Functional prediction analysis indicated that the pathogenesis of food stagnation and GSQ intervention were primarily associated with carbohydrate,lipid,and amino acid metabolism,among other metabolic pathways.Conclusion The digestive mechanism of GSQ may be attributed to its role in restoring diversity and abundance within the intestinal flora,thereby improving the composition and structure of the intestinal flora in mice and subsequently influencing the regulation of metabolic pathways.

Polymorphic Analysis of TLR2 Gene in Native Hainan Pig Breeds Based on Sequencing Technology

[Objective]The paper was to understand the polymorphism of TLR2 gene in native Hainan pig breeds.[Method]TLR2 gene were cloned from blood samples of Wuzhishan pigs,Lingao pigs and Tunchang pigs by PCR and sequenced.[Result]The DNA sequence of TLR2 gene in native Hainan pig breeds was 2649 bp and its CDS was 2358 bp.The intra-specific alignment of TLR2 gene sequences of the three pigs showed that there were seven nucleotide polymorphisms in Wuzhishan pigs(two of which located in the coding region),five nucleotide polymorphisms in Tunchang pigs(all of which were outside the coding region)and four nucleotide polymorphisms in Lingao pigs(one of which was located in the coding region).The results of inter-specific comparison showed that there were 12 nucleotide polymorphisms in three pig breeds,three of polymorphisms were missense mutations,resulting in changes in amino acids.The results of homologous analysis showed that the TLR2 gene sequences of the three pig breeds were highly conservative,with the homology ranging from 99.6% to 99.9%.Prediction and analysis of protein structure showed that AG mutation at 876 and 1454 sites of TLR2 gene in native Hainan pigs caused changes in secondary and tertiary structure of the protein,suggesting there might be possible changes in the function of TLR2.[Conclusion]The study provided reference for further research on the relationship between polymorphism of TLR2 gene and epidemic susceptibility of pigs.

Application of gene sequencing directly to identify the pathogens in specimens

Background Accurate identification of bacterial isolates is an essential task in clinical microbiology. This study compared culturing to analyzing 16S rRNA gene sequences as methods to identify bacteria in clinical samples. We developed a key technique to directly identify bacteria in clinical samples via nucleic acid sequences, thus improving the ability to confirm pathogens.Methods We obtained 225 samples from Beijing Tongran Hospital and examined them by conventional culture and 16S rDNA sequencing to identify pathogens. This study made use of a modified sample pre-treatment technique which came from our laboratory to extract DNA. 16S rDNA was amplified by PCR. The amplified product was sequenced on a CEQ8000 capillary sequencer. Sequences were uploaded to the GenBank BLAST database for comparison.Results Among the positively cultivated bacterial strains, seven strains were identified differently by Vitek32 and by 16S rDNA sequencing. Twelve samples that were negative by standard culturing were determined to have pathogens by sequence analysis.Conclusion The use of 16S rRNA gene sequencing can improve clinical microbiology by providing better identification of unidentified bacteria or providing reference identification of unusual strains.

Cloning, sequencing and analyzing of the heavy chain V region genes of human polyreactive antibodies

The heavy chain variable region genes of 5 human polyreactive mAbs generated in our laboratory have been cloned and sequenced using polymerase chain reaction (PCR) technique. We found that 2 and 3 mAbs utilized genes of the VHIV and VHIII families, respectively. The former 2 VH segments were in germline configuration. A common VH segment, with the best similarity of 90.1 % to the published VHIII germline genes, was utilized by 2 different rearranged genes encoding the V regions of other 3 mAbs. This strongly suggests that the common VH segment is a unmutated copy of an unidentified germline VHIII gene. All these polyreactive mAbs displayed a large NDN region (VH-D-JH junction). The entire H chain V regions of these polyreactive mAbs are unusually basic. The analysis of the charge properties of these mAbs as well as those of other poly- and mono- reactive mAbs from literatures prompts us to propose that the charged amino acids with a particular distribution along the H chain V region,especially the binding sites (CDRs), may be an important structural feature involved in antibody polyreactivity.

Amplification and sequencing of a sulfur-rich 10kd prolamin gene from rice seeds

Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far, several sufur-rich seed protein genes have been isolated and the essential amino acid contents of seed proteins were increased in transgenic tobacco and Brassica napus. In this paper we report the isolation and sequencing of the 10kd prolamin gene from seeds. Poly(A) RNA were prepared from the immature endosperms of japonica rice, Sachiminori, 10 d after flowering. Complementary DNAs were synthesized according to Promega Instruction Manual. Two primers were synthesized and their sequences were Primer Ⅰ: CGTCTACACCATCTGGAATC, Primer Ⅱ: GTGTTTGCAGATAGTATGC. The amplified fragraents were inserted into the Sma I site of pGEM-7zf(+) and was used to transform E. coli JM101 after PCR reaction. DNA sequence were determined by Sanger’s Chain-termination method. Synthesis of cDNA. Using mRNAs as

Methotrexate combined with methylprednisolone for the recovery of motor function and differential gene expression in rats with spinal cord injury

Methylprednisolone is a commonly used drug for the treatment of spinal cord injury, but high doses of methylprednisolone can increase the incidence of infectious diseases. Methotrexate has anti-inflammatory activity and immunosuppressive effects, and can reduce in- flammation after spinal cord injury. To analyze gene expression changes and the molecular mechanism of methotrexate combined with methylprednisolone in the treatment of spinal cord injury, a rat model of spinal cord contusion was prepared using the PinPointTM preci- sion cortical impactor technique. Rats were injected with methylprednisolone 30 mg/kg 30 minutes after injury, and then subcutaneously injected with 0.3 mg/kg methotrexate 1 day after injury, once a day, for 2 weeks. TreadScan gait analysis found that at 4 and 8 weeks after injury, methotrexate combined with methylprednisolone significantly improved hind limb swing time, stride time, minimum longitudinal deviation, instant speed, footprint area and regularity index. Solexa high-throughput sequencing was used to analyze differential gene ex- pression. Compared with methylprednisolone alone, differential expression of 316 genes was detected in injured spinal cord treated with methotrexate and methylprednisolone. The 275 up-regulated genes were mainly related to nerve recovery, anti-oxidative, anti-inflammatory and anti-apoptotic functions, while 41 down-regulated genes were mainly related to proinflammatory and pro-apoptotic functions. These results indicate that methotrexate combined with methylprednisolone exhibited better effects on inhibiting the activity of inflammatory cytokines and enhancing antioxidant and anti-apoptotic effects and thereby produced stronger neuroprotective effects than methotrexate alone. The 316 differentially expressed genes play an important role in the above processes.

Inherited Genetic Susceptibility to Nonimmunosuppressed Epstein-Barr Virus-associated T/NK-cell Lymphoproliferative Diseases in Chinese Patients

Epstein-Barr virus(EBV)T/NK-cell lymphoproliferative diseases are characterized by clonal expansion of EBV-infected T or NK cells,including chronic active EBV infection of T/NK-cell type(CAEBVT/NK),EBV-associated hemophagocytic lymphohistiocytosis(EBV HLH),extranodal NK/T-cell lymphoma of nasal type(ENKTL),and aggressive NK-cell leukemia(ANKL).However,the role of inherited genetic variants to EBV+T/NK-LPDs susceptibility is still unknown.A total of 171 nonimmunosuppressed patients with EBV T/NK-LPDs and 104 healthy donors were retrospectively collected and a targeted sequencing study covering 15 genes associated with lymphocyte cytotoxicity was performed.The 94 gene variants,mostly located in UNCI 3D,LYST,ITK,and PRF1 genes were detected,and mutations covered 28/50(56.00%)of CAEBV-T/NK,31/51(60.78%)of EBV HLH,13/28(46.42%)of ENKTL,and 13/48(27.09%)of ANKL.Most mutations represented monoallelic and missense.Three-year overall survival rate of patients with CAEBV-T/NK and EBV+HLH was significantly lower in patients with germline mutations than in those without germline mutations(P=0.0284,P=0.0137).Our study provided novel insights into understanding a spectrum of nonimmunosuppressed EBV*T/NK-LPDs with respect to genetic defects associated with lymphocyte cytotoxicity and reminded us that the gene sequencing may be an auxiliary test for diagnosis and risk stratification of EBV+T/NK-LPDs.

Detection of Exogenous Gene Copies in Transgenic Soybean by Taqman Quantitative PCR Technique

[Objective] Taqman Quantitative PCR technique was adopted to detect the copies of exogenous nos terminator in transgenic hybrid soybean.[Method] With soybean Lectin as the endogenous reference gene,and gene complex DNA in non-GMO soybeans as the endogenous reference standard,the method of gradient dilution was used for separately calculate Ct value of endogenous reference gene and plasmid DNA and correlation standard curve equation of logarithm of copies,and then to calculate the copies of samples through substituting thus-obtained Ct into the standard curve equation.[Result] The standard curve equation of endogenous reference gene is y=-3.422x＋35.201,R2=0.998;and the standard curve equation of exogenous gene is y=-3.348x＋34.890,R2=0.999.Nos terminator and its lower boundary sequences in transgenic soybean is of single copy.[Conclusion] The study has provided a theoretical basis for determining exogenous gene copies in transgenic soybean.

Social Robot Detection Method with Improved Graph Neural Networks

Social robot accounts controlled by artificial intelligence or humans are active in social networks,bringing negative impacts to network security and social life.Existing social robot detection methods based on graph neural networks suffer from the problem of many social network nodes and complex relationships,which makes it difficult to accurately describe the difference between the topological relations of nodes,resulting in low detection accuracy of social robots.This paper proposes a social robot detection method with the use of an improved neural network.First,social relationship subgraphs are constructed by leveraging the user’s social network to disentangle intricate social relationships effectively.Then,a linear modulated graph attention residual network model is devised to extract the node and network topology features of the social relation subgraph,thereby generating comprehensive social relation subgraph features,and the feature-wise linear modulation module of the model can better learn the differences between the nodes.Next,user text content and behavioral gene sequences are extracted to construct social behavioral features combined with the social relationship subgraph features.Finally,social robots can be more accurately identified by combining user behavioral and relationship features.By carrying out experimental studies based on the publicly available datasets TwiBot-20 and Cresci-15,the suggested method’s detection accuracies can achieve 86.73%and 97.86%,respectively.Compared with the existing mainstream approaches,the accuracy of the proposed method is 2.2%and 1.35%higher on the two datasets.The results show that the method proposed in this paper can effectively detect social robots and maintain a healthy ecological environment of social networks.

On four closely related hypotrichous ciliates(Protozoa,Ciliophora,Spirotrichea):molecular characters,interspecific relationships and phylogeny defined with multigene sequence information

In order to clarify the phylogeny and relationships of the most confused hypotrichous ciliates,Holosticha-complex,four closely related holostichids（five populations）,Holosticha bradburyae,H.diademata,Anteholosticha sp.,and A.manca,were compared and analyzed using ITS2 secondary structures,ITS1-5.8S-ITS2 region and SSrRNA gene sequences.The ITS1-5.8S-ITS2 region sequences of these four species were first sequenced,and they shared sequence identities ranging from 68.0% to 90.1%,while two populations of Anteholosticha sp.differed in three nucleotides（sequence identity 99.8%）.There were several minor differences among ITS2 secondary structures of these species,while two populations of Anteholosticha sp.had the identical secondary structure.Phylogenetic trees inferred from the ITS1-5.8S-ITS2 region sequences of stichotrichs using multiple algorithms（Neighbor-Joining,Maximum Parsimony and Bayesian） revealed similar topologies.The results show that：（1） Holosticha bradburyae and H.diademata firmly clustered together with strong bootstrap supports,forming a sister clade with Anteholosticha sp.,（2） Anteholosticha appeared to be a paraphyletic assemblage,in which the morphotype A.manca was more closely related to Diaxonella trimarginata than to its congener Anteholosticha sp.Phylogenetic analyses based on the SSrRNA gene and the combined sequences of SSrRNA gene and ITS1-5.8S-ITS2 region revealed the similar relationships between Holosticha and Anteholosticha,nevertheless their positions within the subclass Stichotrichia differed from each other inferred from different genes.

Impact of Different Rates of Nitrogen Supplementation on Soil PhysicochemicalProperties and Microbial Diversity in Goji Berry

Goji berry(Lycium barbarum L.)is substantially dependent on nitrogen fertilizer application,which can signifi-cantly enhance fruit yield and Goji berry industrial development in Ningxia,China.This study aimed to analyze the functions of differential nitrogen application rates including low(N1),medium(N2),and high(N3)levels in soil microbial community structure(bacterial and fungal)at 2 diverse soil depths(0-20,20-40 cm)through high-throughput sequencing technology by targeting 16S RNA gene and ITS1&ITS2 regions.All the observed physicochemical parameters exhibited significant improvement(p<0.05)with increased levels of nitrogen and the highest values for most parameters were observed at N2.However,pH decreased(p<0.05)gradually.The alpha and beta diversity analyses for bacterial and fungal communities’metagenome displayed more similarities than differences among all groups.The top bacterial and fungal phyla and genera suggested no obvious(p>0.05)differences among three group treatments(N1,N2,and N3).Furthermore,the functional enrichment analysis demonstrated significant(p<0.05)enrichment of quorum sensing,cysteine and methionine metabolism,and transcriptional machinery for bacterial communities,while various saprotrophic functional roles for fungal communities.Conclusively,moderately reducing the use of N-supplemented fertilizers is conducive to increasing soil nitrogen utilization rate,which can contribute to sustainable agriculture practices through improved soil quality,and microbial community structure and functions.

Preliminary study on mitochondrial 16S rRNA gene sequences and phylogeny of flatfishes (Pleuronectiformes)

A 605 bp section of mitochondrial 16S rRNA gene from Paralichthys olivaceus, Pseudorhombus cinnamomeus, Psetta maxima and Kareius bicoloratus, which represent 3 families of Order Pleuronectiformes was amplified by PCR and sequenced to show the molecular systematics of Pleuronectiformes for comparison with related gene sequences of other 6 flatfish downloaded from GenBank. Phylogenetic analysis based on ge- netic distance from related gene sequences of 10 flatfish showed that this method was ideal to explore the rela- tionship between species, genera and families. Phylogenetic trees set-up is based on neighbor-joining, maximum parsimony and maximum likelihood methods that accords to the general rule of Pleuronectiformes evolution. But they also resulted in some confusion. Unlike data from morphological characters, P. olivaceus clustered with K. bicoloratus, but P. cinnamomeus did not cluster with P. olivaceus, which is worth further studying.

Gene Sequence, Soluble Expression and Homologous Comparison of a D-Hydantoinase fromPseudomonas putida YZ-26

A 1440bp open-reading frame encoding D-hydantoinase from Pseudomonas putida YZ-26 was cloned and sequenced（ GenBank AY387829）. The DNA fragment was inserted into Nde and BamHI sites of vector pET-3a, yielding a recombinant plasmid, pET-HDT. After being transferred into the host strain, the artificial strain, pET-HDT/ E. coli BL21 can express the D-hydantoinase as the soluble form in the Lura-Bertani medium without addition of any inducers. The activity of the enzyme toward substrate DL-hydantoin can reach 3000-4000 IU per cells from one-liter bacterial culture incubated at 30 ℃ for 10-12 h. By the comparison of amino acid sequence homology, hydrophobic residues analysis and secondary structure prediction, it was found that D-hydantoinase reported herein is quite similar to that from Pseudomonas putdia CCRC12857, and alike to that from Pseudomonas putdia DSM84 or other bacteria. A rapid and efficient purification procedure of the enzyme was performed by a three-step procedure： ammonium sulfate fractionation, phenyl Sepharose hydrophobic interaction chromatography and Sephacryl S-200 gel filtration. The molecular mass of the monomeric enzyme is 52042 Da as determined by MALDI-TOF mass spectrometry.

Correlation between ECT2 gene expression and methylation change of ECT2 promoter region in pancreatic cancer

BACKGROUND: Pancreatic cancer is closely related to epigenetic abnormality. The epithelial cell transforming sequence 2 gene (ECT2) plays a critical role in Rho activation during cytokinesis, and thus may play a role in the pathogenesis of pancreatic cancer. In this study, we investigated the relationships between aberrant expression and epigenetic changes of the ECT2 gene in pancreatic cancer. METHODS: Four cell lines (PANC-1, Colo357, T3M-4 and PancTu I) and pancreatic ductal adenocarcinoma (PDAC) tissues were used for mRNA detection. After restriction isoschizomer endonucleases (Msp I/Hpa II) were used to digest the DNA sequence (5'-CCGG-3'), PCR was made to amplify the product. And RT-PCR was applied to determine the expression of the gene. RESULTS: The mRNA expression of the ECT2 gene was higher in pancreatic tumor tissue than in normal tissue. The gene was also expressed in the 4 PDAC cell lines. The methylation states of the upstream regions of the ECT2 gene were almost identical in normal, tumor pancreatic tissues, and the 4 PDAC cell lines. Some of the 5'-CCGG-3' areas in the upstream region of ECT2 were methylated, while others were unmethylated. CONCLUSIONS: The oncogene ECT2 is overexpressed in pancreatic tumor tissues as verified by RT-PCR detection. The methylation status of DNA in promoter areas is involved in the gene expression, along with other factors, in pancreatic cancer.

Isolation and Genetic Analysis of Halophilous Bacteria from Marine Sediment Collected at Tianjin Port, China

[Objective] Marine sediment from Tianjin Port has a extremely high salinity.The bacteria which live in such habitats have evolved distinct physiological,metabolic,and morphological characteristics to survive.The objective of this study is to identify all the specific salt-tolerant characteristics and the genetic evolution of the bacteria in the sediment.[Methods] In this study,the total DNA of sediment from Tianjin Port was extracted,and 16S rDNA was used to conduct an analysis of the fauna of sediment bacteria. We also isolated sediment bacteria using beef extract-peptone media with seven different NaCl concentrations (0,0.5%,2%,5%,10%,15%,and 20%),aiming to analyze the dominant species of halophilous bacteria under different salinities.[Results] 1) With each stepwise increase of salinity from 0.5% to 20%,the total number of isolated bacterial colonies decreased.14 strains of bacteria were identified and classified by the16S rDNA sequencing analysis.Of these,four could tolerate 0~2% salinity,four could tolerate 0~5% salinity,one could tolerate 0~15% salinity,and one tolerated within the full 0~20% salinity range.Further four strains were only able to tolerate within a few narrow salinity ranges.such as 5%~10%,10%~15%,10%~20% and 15%~20%;2) The quantity of bacteria strains that can be isolated from the marine sediment decreased with the increase of salinity. Also, the Shannon wiener index and species richness index of marine sediment bacteria decreased significantly from 5% salinity.However,there were no significant differences in the species evenness index;3) When the salinity was 0~10%,the dominant species was Bacillus.When the salinity was 15%, Halomonas was the dominant species.When the salinity was 20%,there were no significant differences in the proportions of these species.[Conclusion] Our results showed that some bacteria could tolerate living conditions with high salinity,and we even found a species which can tolerate a wide range of salinities (0~20%).In further study,it would be valuable to analyze these bacteria's unique physiological and biochemical functions that allow them to adapt to environments with high salinity.It can provide theories to promote the development of microbial population resources in marine sediment and the reclaimation of salinized soil by salt tolerant microorganisms.

Characterization of root-associated bacterial community structures in soybean and corn using locked nucleic acid(LNA) oligonucleotide-PCR clamping and 454 pyrosequencing

supported in part by grants from the Strategic Priority Research Program of Chinese Academy of Sciences （XDB15010103）;the National Natural Science Foundation of China （41201247）

Sarcopenia and gut microbiota alterations in patients with hematological diseases before and after hematopoietic stem cell transplantation

Objective: The aim of this study was to investigate the prevalence of sarcopenia(SP) and its relationship with gut microbiota alterations in patients with hematological diseases before and after hematopoietic stem cell transplantation(HSCT).Methods: A total of 108 patients with various hematological disorders were selected from Peking University People’s Hospital. SP was screened and diagnosed based on the 2019 Asian Sarcopenia Diagnosis Strategy. Physical measurements and fecal samples were collected, and 16S rRNA gene sequencing was conducted. Alpha and beta diversity analyses were performed to evaluate gut microbiota composition and diversity.Results: After HSCT, significant decreases in calf circumference and body mass index(BMI) were observed,accompanied by a decline in physical function. Gut microbiota analyses revealed significant differences in the relative abundance of Enterococcus, Bacteroides, Blautia and Dorea species before and after HSCT(P<0.05). Before HSCT, sarcopenic patients had lower Dorea levels and higher Phascolarctobacterium levels than non-sarcopenia patients(P<0.01). After HSCT, no significant differences in species abundance were observed. Alpha diversity analysis showed significant differences in species diversity among the groups, with the highest diversity in the postHSCT 90-day group and the lowest in the post-HSCT 30-day group. Beta diversity analysis revealed significant differences in species composition between pre-and post-HSCT time points but not between SP groups. Linear discriminant analysis effect size(LEfSe) identified Alistipes, Rikenellaceae, Alistipes putredinis, Prevotellaceae defectiva and Blautia coccoides as biomarkers for the pre-HSCT sarcopenia group. Functional predictions showed significant differences in anaerobic, biofilm-forming and oxidative stress-tolerant functions among the groups(P<0.05).Conclusions: This study demonstrated a significant decline in physical function after HSCT and identified potential gut microbiota biomarkers and functional alterations associated with SP in patients with hematological disorders. Further research is needed to explore the underlying mechanisms and potential therapeutic targets.