Background: Protein kinase B (AKT/PKB) family is frequently amplified in ovarian cancer (OC). To the greatest of our knowledge, there is a lack of published reports about the amplification of the genes belonging to th...Background: Protein kinase B (AKT/PKB) family is frequently amplified in ovarian cancer (OC). To the greatest of our knowledge, there is a lack of published reports about the amplification of the genes belonging to the AKT family among Sudanese women with OC. The present study was conducted to detect the AKT1 gene amplification and its association with tumour types, grades, and ages among Sudanese women with OC, bearing in mind the ethnic variation. Methods: This institution-based study included 79 cases of women diagnosed with ovarian cancer (OC) at Omdurman Maternity Hospital in the period 2013-2018. Formalin-fixed, paraffin-embedded (FFPE) tissue sections were used to extract RNA. AKT1 gene amplification was assessed using quantitative real-time PCR. Results: The mean age (±SD) of included women was 49.29 (±13.612). The amplification of AKT1 gene was observed in 18/79 (22.8%) of OC women, with a high frequency in women with undifferentiated 1/2 (50%), clear cell 2/6 (33.3%), mucinous 3/11 (27.3%), endometrioid 3/17 (17.6%), and serous carcinomas 5/30 OC (16.7%). High frequency was seen in women with low (26.3%;n = 10/28) rather than in higher (19.5%;n = 8/33) grade carcinoma, and in older (25.8%;n = 8/23) rather than younger (18.2%;n = 2/9) women. No significant association between AKT1 gene amplification and tumour types, grades, and ages of women was observed (Fisher’s Exact test: p = 0.405, 0.593 and 0.851, respectively). Conclusion: AKT1 gene amplification arises in around one-fifth of Sudanese women with ovarian cancer (OC). It is seen more in undifferentiated, clear cell, and mucinous tumours types, and more frequently in low tumour grade and older women, but not to a statistically significant level. These outcomes sustenance previous studies suggesting that activated AKT genes have a vital role in OC progression and may offer a plan for targeted therapy and prognostic evaluation.展开更多
Induction of c-myc gene amplification in L1210 cells by hydroxyurea and its inhibition by homohar-ringtonine were investigated using the DNA-DNA molecular hybridization technique. When the cells were treated with hydr...Induction of c-myc gene amplification in L1210 cells by hydroxyurea and its inhibition by homohar-ringtonine were investigated using the DNA-DNA molecular hybridization technique. When the cells were treated with hydroxyurea 1.0 mM for 16 hours, and incubated a further 16 hours in a drug-free medium, the c-myc gene amplified 23.5-fold. If homohar-ringtonine 50 μM was used at the same time as hydroxyurea, gene amplification did not occur. Cycloheximide, an inhibitor of protein biosynthesis, produced a similar effect. Our results indicated that a (or some) protein factor(s) might be involved in gene amplification. Detailed analysis showed that the synthesis of this protein factor(s) started 4 hours before the initiation of the S phase but did not continue in the S phase. It was also found that this protein factor(s) was very labile and began to degrade 2 hours after its appearance.展开更多
Three genetic mechanisms activate oncogenes in human neoplasms: 1) mutations, 2) gene amplification, and 3) chromosome rearrangements. These mechanisms result in either an alteration of protooncogene structure or an i...Three genetic mechanisms activate oncogenes in human neoplasms: 1) mutations, 2) gene amplification, and 3) chromosome rearrangements. These mechanisms result in either an alteration of protooncogene structure or an increase in protooncogene expression. The role of epigenetic aberrancies in carcinogenesis has been described earlier however to clinicians, the biological implications of epigenetic therapies to prevent cancer and the mechanisms involved have been a mystery. Furthermore, there is no biomarker suggested to track the carcinogenesis steps long before cancer develops, and this has caused a significant lack of proactive and preventive measures to be taken as all recommendations in preventive oncology are either deficiently and blindly made or through screening methods which are too late in the game. Here we explored a very different approach by applying our deepest understanding of epigenetics and carcinogenesis and even further we developed a framework where our clinical findings could translate to the research and vice versa by generating advanced and novel hypotheses on “how we get cancer”, by exploring the relation between the host and the tumor cells in a way no one had perceived before. The role of specific cancer stem cell pathways is dissected and how to inhibit each of these initiators using multitargeted epigenetic therapies and off-label medications are explained. We should admit that without considering this sophisticated amazing biological network, cancer will remain an unsolved challenge. Further, we were able to solve this unsolved puzzle by bridging the gap from a hypothetical point of view/hypothesis to possibilities that explain the clinical findings we had observed, and conclude that such an approach can completely change the way practitioners are treating cancer.展开更多
Objective: To review the prevalence and prognostic significance of fibroblast growth factor receptor 1 (FGFRI) amplification and to establish an association between FGFRI amplification and the clinical characterist...Objective: To review the prevalence and prognostic significance of fibroblast growth factor receptor 1 (FGFRI) amplification and to establish an association between FGFRI amplification and the clinical characteristics of nonsmall cell lung cancer (NSCLC). Data Sources: We searched PubMed for English-language studies published between January 2010 and May 2016. Study Selection: We included all relevant articles, with no limitation of study design. Results: FGFRI amplification was reported in 8.7-20.0% of NSCLC cases and was significantly more frequent in squamous cell carcinomas (SCCs) (9.7-28.3%) than in adenocarcinomas (ADCs) (0-15.0%). The rates of FGFRI amplification were as follows: males, 13.9-22.1%; females, 0-20.1%; Stage 1 NSCLC, 9.3-24.1%; Stage II NSCLC, 12.9-25.0%; Stage 111 NSCLC, 8.2-19.5%: Stage IV NSCLC, 0-12.5%; current smokers, 13.3-29.0%; former smokers, 2.5-23.0%; and nonsmokers, 0-22.2%. Overall survival was 43.9-70.8 months in patients with FGFRI amplification and 42.4-115.0 months in patients with no FGFRI amplification; disease-free survival was 22.5-58.5 months and 52.4-94.6 months, respectively. Conclusions: FGFR1 amplification is more frequent in SCCs than in ADCs. The association between FGFRI amplification and clinical characteristics (gender, smoking status, and disease stage) and the prognostic significance of FGFRI amplification in NSCLC remain controversial.展开更多
Background:Epigenetic alterations have been shown to contribute immensely to human carcinogenesis.Dynamic and reversible N6-methyladenosine(m6A)RNA modification regulates gene expression and cell fate.However,the reas...Background:Epigenetic alterations have been shown to contribute immensely to human carcinogenesis.Dynamic and reversible N6-methyladenosine(m6A)RNA modification regulates gene expression and cell fate.However,the reasons for activation of KIAA1429(also known as VIRMA,an RNA methyltransferase)and its underlying mechanism in lung adenocarcinoma(LUAD)remain largely unexplored.In this study,we aimed to clarify the oncogenic role of KIAA1429 in the tumorigenesis of LUAD.Methods:Whole-genome sequencing and transcriptome sequencing of LUAD data were used to analyze the gene amplification of RNA methyltransferase.The in vitro and in vivo functions of KIAA1429 were investigated.Transcriptome sequencing,methylated RNA immunoprecipitation sequencing(MeRIP-seq),m6A dot blot assays and RNA immunoprecipitation(RIP)were performed to confirm the modified gene mediated by KIAA1429.RNA stability assays were used to detect the half-life of the target gene.Results:Copy number amplification drove higher expression of KIAA1429 in LUAD,whichwas correlatedwith poor overall survival.Manipulating the expression of KIAA1429 could regulate the proliferation and metastasis of LUAD.Mechanistically,the target genes of KIAA1429-mediated m6A modification were confirmed by transcriptome sequencing and MeRIP-seq assays.We also revealed that KIAA1429 could regulate BTG2 expression in an m6A-dependent manner.Knockdown of KIAA1429 significantly decreased the m6A levels of BTG2 mRNA,leading to enhanced YTH m6A RNA binding protein 2(YTHDF2,the m6A“reader”)-dependent BTG2 mRNA stability and promoted the expression of BTG2;thus,participating in the tumorigenesis of LUAD.Conclusions:Our data revealed the activation mechanism and important role of KIAA1429 in LUAD tumorigenesis,which may provide a novel view on the targeted molecular therapy of LUAD.展开更多
For first-line non-small-cell lung cancer(NSCLC) therapy,detecting mutation status of the epidermal growth factor receptor(EGFR) gene constitutes a prudent test to identify patients who are most likely to benefit ...For first-line non-small-cell lung cancer(NSCLC) therapy,detecting mutation status of the epidermal growth factor receptor(EGFR) gene constitutes a prudent test to identify patients who are most likely to benefit from EGFR-tyrosine kinase inhibitor(TKI) therapy.Now,the material for detecting EGFR gene mutation status mainly comes from formalin-fixed and paraffin-embedded(FFPE) tissues.DNA extraction from FFPE and the amplification of EGFR gene by polymerase chain reaction(PCR) are two key steps for detecting EGFR gene mutation.We showed a simple method of DNA extraction from FFPE tissues for the effective amplification of EGFR gene.Extracting DNA from the FFPE tissues of NSCLC patients with 1% Triton X-100(pH=10.0) was performed by heating at 95 °C for 30 min.Meanwhile,a commercial kit was used to extract DNA from the same FFPE tissues of NSCLC patients for comparison.DNA extracted products were used as template for amplifying the exons 18,19,20 and 21 of EGFR by PCR for different amplified fragments.Results show that DNA fragment size extracted from FFPE tissues with 1% Triton X was about 250―500 base pairs(bp).However,DNA fragment size extracted from FFPE tissues via commercial kit was about from several hundreds to several thousands bp.The DNA yield extracted from FFPE tissues with 1% Triton X was larger than that via commercial kit.For about 500 bp fragment,four exons of EGFR could not be amplified more efficiently from extracted DNA with 1% Triton X than with commercial kit.However,for about 200 bp fragment.This simple and non-laborious protocol could successfully be used to extract DNA from FFPE tissue for the amplification of EGFR gene by PCR,further screening of EGFR gene mutation and facilitating the molecular analysis of a large number of FFPE tissues from NSCLC patients.展开更多
Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far...Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far, several sufur-rich seed protein genes have been isolated and the essential amino acid contents of seed proteins were increased in transgenic tobacco and Brassica napus. In this paper we report the isolation and sequencing of the 10kd prolamin gene from seeds. Poly(A) RNA were prepared from the immature endosperms of japonica rice, Sachiminori, 10 d after flowering. Complementary DNAs were synthesized according to Promega Instruction Manual. Two primers were synthesized and their sequences were Primer Ⅰ: CGTCTACACCATCTGGAATC, Primer Ⅱ: GTGTTTGCAGATAGTATGC. The amplified fragraents were inserted into the Sma I site of pGEM-7zf(+) and was used to transform E. coli JM101 after PCR reaction. DNA sequence were determined by Sanger’s Chain-termination method. Synthesis of cDNA. Using mRNAs as展开更多
Objective: To observe the expression of mouse Tbx2 gene in normal and malignant melanophore. Methods: The normal and malignant cells were used to extract total RNA. The expression of the Tbx2 gene was detected by RT-P...Objective: To observe the expression of mouse Tbx2 gene in normal and malignant melanophore. Methods: The normal and malignant cells were used to extract total RNA. The expression of the Tbx2 gene was detected by RT-PCR. Results: No expression of the Tbx2 gene in the normal melanocytes was noted, but all malignant cells showed expression of the Tbx2 gene. Conclusion: Tbx2 plays a critical role during the development of the malignant cells.展开更多
[Objectives]To clone and analyze the TpiA gene of Vibrio alginolyticus HY9901.[Methods]According to the TpiA gene sequence of V.alginolyticus,a pair of specific primers was designed,and its full length was amplified b...[Objectives]To clone and analyze the TpiA gene of Vibrio alginolyticus HY9901.[Methods]According to the TpiA gene sequence of V.alginolyticus,a pair of specific primers was designed,and its full length was amplified by PCR.[Results]The full length of TpiA gene is 771 bp,encoding 256 amino acid residues in total,and the NCBI accession number is OM906798.According to the deduced amino acid sequence,its molecular weight was predicted to be about 26.97548 kDa,and its isoelectric point was 4.78.The amino acid sequence of the N-terminal signal peptide structure was predicted,and it was found that there was no obvious signal peptide cleavage site,no signal peptide,and no transmembrane region;the amino acid sequence contained 3 N-glycosylation sites,4 protein kinase C phosphorylation sites,2 casein kinase II phosphorylation sites,6 N-myristoylation sites,7 microbody C-terminal target signal site,and 1 triose phosphate isomerase active site.The prediction results of protein subcellular localization showed that TpiA may be located in mitochondria or cytoplasm,with probability of 39.1%and 34.8%,respectively.The amino acid sequence of the TpiA gene of V.alginolyticus shared 98.83%-99.61%homology with other Vibrio species,and it was clustered into the same subfamily with Vibrio parahaemolyticus and had a close relationship.In the secondary structure prediction,the proportions ofα-helix,random coil and extended chain were 44.53%,41.41%and 14.06%,respectively,and the similarity of its tertiary structure model to template 1aw1.1.A was 85.16%.[Conclusions]This study is intended to provide a basis for further research on the role of TpiA gene in the type III secretion system and related research on antibiotic resistance.展开更多
[Objective]To clone and identify Marek's disease virus ( MDV) serum gene. [Method]MDV genomic DNA was extracted from lymphoid tissues of the diseased chickens with latent MDV infection. The MDV L-meq gene was ampli...[Objective]To clone and identify Marek's disease virus ( MDV) serum gene. [Method]MDV genomic DNA was extracted from lymphoid tissues of the diseased chickens with latent MDV infection. The MDV L-meq gene was amplified by gradient PCR,inserted into pMD18-T vector and sequenced. The sequence was analyzed using DNAman software. [Result] The obtained sequence had 100% similarity with the published se- quence of L-meq gene,showing successful amplification of target gene. [Conclusion]The paper provides new ideas and new methods for preven- tion and treatment of Marek's disease in chickens.展开更多
Aim: To investigate human epidermal growth factor receptor type 2 (HER2) protein expression and gene amplification in Chinese metastatic prostate cancer patients and their potential value as prognostic factors. Met...Aim: To investigate human epidermal growth factor receptor type 2 (HER2) protein expression and gene amplification in Chinese metastatic prostate cancer patients and their potential value as prognostic factors. Methods: Immunohistochemistry (IHC) was performed to investigate HER2 protein expression in prostate biopsy specimens from 104 Chinese metastatic prostate cancer patients. After 3-11 months of hormonal therapy, 12 patients underwent transurethral resection of the prostate (TURP). HER2 protein expression of TURP specimens was compared with that of the original biopsy specimens. Of these, 10 biopsy and 4 TURP specimens with HER2 IHC staining scores ≥ 2+ were investigated for HER2 gene amplification status by fluorescent in situ hybridization (FISH). Results: Of the 104 prostate biopsy specimens, HER2 protein expression was 0, 1+, 2+ and 3+ in 49 (47.1%), 45 (43.3%), 8 (7.7%) and 2 (1.9%) cases, respectively. There was a significant association between HER2 expression and Gleason score (P = 0.026). HER2 protein expression of prostate cancer tissues increased in 33.3% of patients after hormonal therapy. None of the 14 specimens with HER2 IHC scores 〉 2+ showed HER2 gene amplification. Patients with HER2 scores 〉 2+ had a significantly higher chance of dying from prostate cancer than those with HER2 scores of 0 (P = 0.004) and 1+ (P = 0.034). Multivariate Cox regression analysis showed that HER2 protein expression intensity was an independent predictor of cancer-related death (P = 0.039). Conclusion: An HER2 IHC score 〉 2+ should be defined as HER2 protein overexpression in prostate cancer. Overexpression of HER2 protein in cancer tissue might suggest an increased risk of dying from prostate cancer. HER2 protein expression increases in some individual patients after hormonal therapy.展开更多
Objective: Angiogennesis, the formation of new blood vessels from the existing vascular bed, is essential step for growth and invasion of primary rumor. Vascular endothelial growth factor (VEGF) is known to play cr...Objective: Angiogennesis, the formation of new blood vessels from the existing vascular bed, is essential step for growth and invasion of primary rumor. Vascular endothelial growth factor (VEGF) is known to play crucial role in tumor angiogenesis. In the present study, we investigate the expression of VEGF and VEGF-mRNA in the angiogennesis, metastasis and prognosis of lung cancer. Methods: The VEGF cellular distributions and expression in 38 specimens of patients with lung cancer were investigated with immunohistochemistry stain technology. The total RNAs in 38 tissues of lung cancer was measured, then the levels of VEGF-mRNA expression were analyzed by a reverse-transcription polymerase chain reaction (RT-PCR) assay. The levels of VEGF in sera of patients with lung cancer, benign lung diseases and healthy controls were detected through Enzyme linked immunosorbent assay (ELISA) method. Results: The VEGF positive stain was 76% in 38 cases of lung cancer specimens. The 89% rate of VEGF stain was found for clinical stage Ⅲ cases and 92% for stage Ⅳ lung cancers. The significantly higher expression of VEGF was evidenced in patients with lymph node metastasis (84%), distant metastasis (90%), and lung cancers with lower histological differentiation (89%), respectively. The expression level of total RNA was significantly higher in patients with lung cancers than that in their paracancerons or distant lung tissues. The VEGF expressions were tightly correlated with total RNA concentration of lung carcinoma ( P 〈 0.01 ). The predominant expressions of VEGF121 and VEGF165 gene fragments were found in lung cancer specimens by RT-PCR analysis. No significant difference of serum VEGF levels was detected between cases with lung cancer and patients with benign diseases. However, the VEGF level of cases with benign diseases was decreased significantly after patients with anti-inflammation medication. Conclusion: The present data suggested that the rumor tissue VEGF expression and VEGF-mRNA analysis in patients with lung cancer be a useful indicator for angiogenesis and metastasis of lung cancer.展开更多
Objective:Dysfunction in fibroblast growth factor receptor(FGFR)signaling has been reported in diverse cancer types,including non-small cell lung cancer(NSCLC).The frequency of FGFR aberrations in Chinese NSCLC patien...Objective:Dysfunction in fibroblast growth factor receptor(FGFR)signaling has been reported in diverse cancer types,including non-small cell lung cancer(NSCLC).The frequency of FGFR aberrations in Chinese NSCLC patients is therefore of great clinical significance.Methods:A total of 10,966 NSCLC patients whose tumor specimen and/or circulating cell-free DNA(cf DNA)underwent hybridization capture-based next-generation sequencing were reviewed.Patients'clinical characteristics and treatment histories were also evaluated.Results:FGFR aberrations,including mutations,fusions,and gene amplifications,were detected in 1.9%(210/10,966)of the population.FGFR abnormalities were more frequently observed in lung squamous cell carcinomas(6.8%,65/954)than lung adenocarcinomas(1.3%,128/9,596).FGFR oncogenic mutations were identified in 19 patients(~0.17%),of which,68%were male lung squamous cell carcinoma patients.Eleven out of the 19 patients(58%)had concurrent altered PI3 K signaling,thus highlighting a potential combination therapeutic strategy of dual-targeting FGFR and PI3 K signaling in such patients.Furthermore,FGFR fusions retaining the intact kinase domain were identified in 12 patients(0.11%),including 9 FGFR3-TACC3,1 FGFR2-INA,1 novel FGFR4-RAPGEFL1,and 1 novel fusion between the FGFR1 and SLC20 A25′-untranslated regions,which may have caused FGFR1 overexpressions.Concomitant EGFR mutations or amplifications were observed in 6 patients,and 4 patients received anti-EGFR inhibitors,in whom FGFR fusions may have mediated resistance to anti-EGFR therapies.FGFR amplification was detected in 24 patients,with the majority being FGFR1 amplifications.Importantly,FGFR oncogenic mutations,fusions,and gene amplifications were almost always mutually exclusive events.Conclusions:We report the prevalence of FGFR anomalies in a large NSCLC population,including mutations,gene amplifications,and novel FGFR fusions.展开更多
Objective: Sequencing of mouse Tbx2 gene andobserving the expression of Tbx2 gene in normal andmalignant melanophore. Methods: The PCR productsof TbX2 cDNA were cloned into PUC18 vector andsequenced. The normal and ma...Objective: Sequencing of mouse Tbx2 gene andobserving the expression of Tbx2 gene in normal andmalignant melanophore. Methods: The PCR productsof TbX2 cDNA were cloned into PUC18 vector andsequenced. The normal and malignant melanocytes wereused to extract total RNA. The expression of Tbx2 genewas detected by RT-PCR. Results: The TbXZ genome iscomposed of seven e-cons and six nitrons. No expressionof Tbx2 gene in the normal melanocytes was noted, butall malignant melanocytes showed expression of TbXZgene. Conclusion: The observation showed the analysisof the genomic structure of mouse TbX2. TbX2 plays acritical role during the development of the malignantmelanophore.展开更多
Objective: To observe the efficacy and safety of cetuximab combined with chemotherapy in advanced non-small-cell lung cancer (NSCLC), and to investigate the association of status of K-RAS gene mutation and epiderma...Objective: To observe the efficacy and safety of cetuximab combined with chemotherapy in advanced non-small-cell lung cancer (NSCLC), and to investigate the association of status of K-RAS gene mutation and epidermal growth factor receptor (EGFR) genotype with clinical outcome. Methods: Between Jan. 2006 and Sep. 2009, nineteen patients with advanced NSCLC received cetuximab (〉4 weeks) combined with chemotherapy in Department of Thoracic Oncology at Beijing Cancer Hospital. Response, survival and toxicity were retrospectively assessed, epidermal growth factor receptor (EGFR) protein expression was evaluated by ELISA Kit. The status of K-RAS gene mutation was tested by PCR-RFLP and EGFR gene amplification was measured by EGFR fluorescence in situ hybridization (FISH). Results: Partial response(PR) was observed in 26.3%(5/19) of the patients and stable disease(SD) in 52.6%(10/19). Median progression free survival(PFS) was 6 months (95% CI: 3.6-8.4). Median overall survival (MST) and 1-year survival rate(SR) were 10.6 months (95% CI: 6.6-14.6) and 47.6%, respectively. Mild or moderate skin rash was the most common toxicity related with cetuximab. K-RAS gene mutation, EGFR protein level and amplification have little correlation with prognosis. Conclusion: Cetuximab combined with chemotherapy was tolerable and the skin rash related with cetuximab was mild to moderate. Cetuximab may prolong survival of the patients who failed to previous chemotherapy.展开更多
Human vascular endothelial growth factor cDNA was amplified by nested polymerase chain reaction method from the HL60 cells. Then a pCD hVEGF 165 recombinant plasmid was constructed. Rabbit osteoblasts were tra...Human vascular endothelial growth factor cDNA was amplified by nested polymerase chain reaction method from the HL60 cells. Then a pCD hVEGF 165 recombinant plasmid was constructed. Rabbit osteoblasts were transfected with pCD hVEGF 165 plasmid by lipofectin mediated gene transfer. The transient expressive results were detected by immunohistochemical method. It was observed that the expression of human VEGF gene was detected 72 h after transfecting distinctly.展开更多
Amplification of biosynthetic gene clusters is important to increase secondary metabolite production.However,the copy number of amplified gene clusters is difficult to control precisely.In this study,the tandem amplif...Amplification of biosynthetic gene clusters is important to increase secondary metabolite production.However,the copy number of amplified gene clusters is difficult to control precisely.In this study,the tandem amplification of a 70 kb bleomycin biosynthetic gene cluster was precisely regulated through the combined strategy of a Zou A-dependent DNA amplification system and double-reporter-guided recombinant selection in Streptomyces verticillus ATCC15003.The production of bleomycin in the recombinant strain containing six copies of the bleomycin gene cluster was 9.59-fold higher than that in the wild-type strain.The combined strategy used in this study is powerful and applicable for precisely regulating the amplification of gene clusters and improving the corresponding secondary metabolite production.展开更多
Background Targeted tumor therapies have been making rapid progress in recent years, and the erbB-2 oncogene is a suitable target. There was much discussion about the level of erbB-2 in osteosarcoma. The aim of this s...Background Targeted tumor therapies have been making rapid progress in recent years, and the erbB-2 oncogene is a suitable target. There was much discussion about the level of erbB-2 in osteosarcoma. The aim of this study was to investigate the erbB-2 amplification or expression status in osteosarcoma. Methods Fluorescence in situ hybridization (FISH) and DNA probes for erbB-2 and centromere 17 were used to examine the erbB-2 gene amplification status in 32 osteosarcoma samples, and expression of erbB-2 was analyzed by immunohistochemistry (IHC) and reverse transcription-polymerase chain reaction (RT-PCR). Results None of the 32 osteosarcomas was observed by FISH to have the erbB-2 gene amplified, and no distinguishable membrane staining was seen in any case yet, nevertheless, erbB-2 overexpression was present in 6 tumor samples by RT-PCR. Conclusions The status of erbB-2 gene amplification and membrane overexpression is rare in osteosarcomas, and might suggest that the erbB-2 target agent should not be applied to osteosarcomas as single treatment.展开更多
Background Clinical programs for preventing β-thalassemia are presently based on prospective carrier screening and prenatal diagnosis. This paper report an achievement of a pregnancy with unaffected embryos using in...Background Clinical programs for preventing β-thalassemia are presently based on prospective carrier screening and prenatal diagnosis. This paper report an achievement of a pregnancy with unaffected embryos using in vitro fertilization and embryo transfer (IVF-ET), in combination with preimplantation genetic diagnosis (PGD), for a couple at risk of having children with β-thalassemia. Methods A couple carrying different thalassemia mutations, both a codon 41-42 mutation and the IVS-II-654 mutation, received standard IVF treatment, with intracytoplasmic sperm injection, embryo biopsiy, single cell polymerase chain reaction (PCR) and DNA analysis. Only unaffected or carrier embryos were transferred to the uterine cavity. After confirmation of pregnancy, a prenatal diagnosis was performed. Results Of a total of 13 embryos analyzed for β-globin mutations, PGD indicated that 2 were normal, 3 were affected, and 6 were carriers. Diagnosis could not be made in the other 2 embryos. Three embryos were transferred to the uterus on the third day after oocyte retrieval. Ultrasonography revealed a twin pregnancy with one blighted ovum. The prenatal genetic diagnosis revealed that both fetuses were unaffected, and two healthy boys were born, confirming the results of PGD. Conclusions We developed a single-cell based primer extension preamplification (PEP)-PCR assay for the detection of β-thalassemia mutations. The assays were efficient and accurate at all stages of the procedure, and resulted in the birth of PGD-confirmed β-thalassemia free children in China. PEP was used here in PGD for β-thalassemia.展开更多
文摘Background: Protein kinase B (AKT/PKB) family is frequently amplified in ovarian cancer (OC). To the greatest of our knowledge, there is a lack of published reports about the amplification of the genes belonging to the AKT family among Sudanese women with OC. The present study was conducted to detect the AKT1 gene amplification and its association with tumour types, grades, and ages among Sudanese women with OC, bearing in mind the ethnic variation. Methods: This institution-based study included 79 cases of women diagnosed with ovarian cancer (OC) at Omdurman Maternity Hospital in the period 2013-2018. Formalin-fixed, paraffin-embedded (FFPE) tissue sections were used to extract RNA. AKT1 gene amplification was assessed using quantitative real-time PCR. Results: The mean age (±SD) of included women was 49.29 (±13.612). The amplification of AKT1 gene was observed in 18/79 (22.8%) of OC women, with a high frequency in women with undifferentiated 1/2 (50%), clear cell 2/6 (33.3%), mucinous 3/11 (27.3%), endometrioid 3/17 (17.6%), and serous carcinomas 5/30 OC (16.7%). High frequency was seen in women with low (26.3%;n = 10/28) rather than in higher (19.5%;n = 8/33) grade carcinoma, and in older (25.8%;n = 8/23) rather than younger (18.2%;n = 2/9) women. No significant association between AKT1 gene amplification and tumour types, grades, and ages of women was observed (Fisher’s Exact test: p = 0.405, 0.593 and 0.851, respectively). Conclusion: AKT1 gene amplification arises in around one-fifth of Sudanese women with ovarian cancer (OC). It is seen more in undifferentiated, clear cell, and mucinous tumours types, and more frequently in low tumour grade and older women, but not to a statistically significant level. These outcomes sustenance previous studies suggesting that activated AKT genes have a vital role in OC progression and may offer a plan for targeted therapy and prognostic evaluation.
文摘Induction of c-myc gene amplification in L1210 cells by hydroxyurea and its inhibition by homohar-ringtonine were investigated using the DNA-DNA molecular hybridization technique. When the cells were treated with hydroxyurea 1.0 mM for 16 hours, and incubated a further 16 hours in a drug-free medium, the c-myc gene amplified 23.5-fold. If homohar-ringtonine 50 μM was used at the same time as hydroxyurea, gene amplification did not occur. Cycloheximide, an inhibitor of protein biosynthesis, produced a similar effect. Our results indicated that a (or some) protein factor(s) might be involved in gene amplification. Detailed analysis showed that the synthesis of this protein factor(s) started 4 hours before the initiation of the S phase but did not continue in the S phase. It was also found that this protein factor(s) was very labile and began to degrade 2 hours after its appearance.
文摘Three genetic mechanisms activate oncogenes in human neoplasms: 1) mutations, 2) gene amplification, and 3) chromosome rearrangements. These mechanisms result in either an alteration of protooncogene structure or an increase in protooncogene expression. The role of epigenetic aberrancies in carcinogenesis has been described earlier however to clinicians, the biological implications of epigenetic therapies to prevent cancer and the mechanisms involved have been a mystery. Furthermore, there is no biomarker suggested to track the carcinogenesis steps long before cancer develops, and this has caused a significant lack of proactive and preventive measures to be taken as all recommendations in preventive oncology are either deficiently and blindly made or through screening methods which are too late in the game. Here we explored a very different approach by applying our deepest understanding of epigenetics and carcinogenesis and even further we developed a framework where our clinical findings could translate to the research and vice versa by generating advanced and novel hypotheses on “how we get cancer”, by exploring the relation between the host and the tumor cells in a way no one had perceived before. The role of specific cancer stem cell pathways is dissected and how to inhibit each of these initiators using multitargeted epigenetic therapies and off-label medications are explained. We should admit that without considering this sophisticated amazing biological network, cancer will remain an unsolved challenge. Further, we were able to solve this unsolved puzzle by bridging the gap from a hypothetical point of view/hypothesis to possibilities that explain the clinical findings we had observed, and conclude that such an approach can completely change the way practitioners are treating cancer.
文摘Objective: To review the prevalence and prognostic significance of fibroblast growth factor receptor 1 (FGFRI) amplification and to establish an association between FGFRI amplification and the clinical characteristics of nonsmall cell lung cancer (NSCLC). Data Sources: We searched PubMed for English-language studies published between January 2010 and May 2016. Study Selection: We included all relevant articles, with no limitation of study design. Results: FGFRI amplification was reported in 8.7-20.0% of NSCLC cases and was significantly more frequent in squamous cell carcinomas (SCCs) (9.7-28.3%) than in adenocarcinomas (ADCs) (0-15.0%). The rates of FGFRI amplification were as follows: males, 13.9-22.1%; females, 0-20.1%; Stage 1 NSCLC, 9.3-24.1%; Stage II NSCLC, 12.9-25.0%; Stage 111 NSCLC, 8.2-19.5%: Stage IV NSCLC, 0-12.5%; current smokers, 13.3-29.0%; former smokers, 2.5-23.0%; and nonsmokers, 0-22.2%. Overall survival was 43.9-70.8 months in patients with FGFRI amplification and 42.4-115.0 months in patients with no FGFRI amplification; disease-free survival was 22.5-58.5 months and 52.4-94.6 months, respectively. Conclusions: FGFR1 amplification is more frequent in SCCs than in ADCs. The association between FGFRI amplification and clinical characteristics (gender, smoking status, and disease stage) and the prognostic significance of FGFRI amplification in NSCLC remain controversial.
基金Science Fund for Creative Research Groups of the National Natural Science Foundation of China,Grant/Award Number:81521004National Natural Science Foundation of China,Grant/Award Numbers:81922061,82172992,81903391,81702266+2 种基金Research Unit of Prospective Cohort of Cardiovascular Diseases and Cancers,Chinese Academy of Medical Sciences,Grant/Award Number:2019RU038Natural Science Foundation of Jiangsu Province,Grant/Award Numbers:BK20211253,BK20190148Postgraduate Research&Practice Innovation Program of Jiangsu Province,Grant/Award Number:KYCX18_0195。
文摘Background:Epigenetic alterations have been shown to contribute immensely to human carcinogenesis.Dynamic and reversible N6-methyladenosine(m6A)RNA modification regulates gene expression and cell fate.However,the reasons for activation of KIAA1429(also known as VIRMA,an RNA methyltransferase)and its underlying mechanism in lung adenocarcinoma(LUAD)remain largely unexplored.In this study,we aimed to clarify the oncogenic role of KIAA1429 in the tumorigenesis of LUAD.Methods:Whole-genome sequencing and transcriptome sequencing of LUAD data were used to analyze the gene amplification of RNA methyltransferase.The in vitro and in vivo functions of KIAA1429 were investigated.Transcriptome sequencing,methylated RNA immunoprecipitation sequencing(MeRIP-seq),m6A dot blot assays and RNA immunoprecipitation(RIP)were performed to confirm the modified gene mediated by KIAA1429.RNA stability assays were used to detect the half-life of the target gene.Results:Copy number amplification drove higher expression of KIAA1429 in LUAD,whichwas correlatedwith poor overall survival.Manipulating the expression of KIAA1429 could regulate the proliferation and metastasis of LUAD.Mechanistically,the target genes of KIAA1429-mediated m6A modification were confirmed by transcriptome sequencing and MeRIP-seq assays.We also revealed that KIAA1429 could regulate BTG2 expression in an m6A-dependent manner.Knockdown of KIAA1429 significantly decreased the m6A levels of BTG2 mRNA,leading to enhanced YTH m6A RNA binding protein 2(YTHDF2,the m6A“reader”)-dependent BTG2 mRNA stability and promoted the expression of BTG2;thus,participating in the tumorigenesis of LUAD.Conclusions:Our data revealed the activation mechanism and important role of KIAA1429 in LUAD tumorigenesis,which may provide a novel view on the targeted molecular therapy of LUAD.
基金Supported by the Jilin Science & Technology Development Plan,China(No.201201060)the Scientific Research Foundation of Jilin Province,China(No.20100942)+1 种基金the Fund of Developing and Reforming Community of Jilin Province,China(No.2010-1928)the Health Scientific Research Foundation of Jilin Province,China(Nos.2009z081,2010Z083)
文摘For first-line non-small-cell lung cancer(NSCLC) therapy,detecting mutation status of the epidermal growth factor receptor(EGFR) gene constitutes a prudent test to identify patients who are most likely to benefit from EGFR-tyrosine kinase inhibitor(TKI) therapy.Now,the material for detecting EGFR gene mutation status mainly comes from formalin-fixed and paraffin-embedded(FFPE) tissues.DNA extraction from FFPE and the amplification of EGFR gene by polymerase chain reaction(PCR) are two key steps for detecting EGFR gene mutation.We showed a simple method of DNA extraction from FFPE tissues for the effective amplification of EGFR gene.Extracting DNA from the FFPE tissues of NSCLC patients with 1% Triton X-100(pH=10.0) was performed by heating at 95 °C for 30 min.Meanwhile,a commercial kit was used to extract DNA from the same FFPE tissues of NSCLC patients for comparison.DNA extracted products were used as template for amplifying the exons 18,19,20 and 21 of EGFR by PCR for different amplified fragments.Results show that DNA fragment size extracted from FFPE tissues with 1% Triton X was about 250―500 base pairs(bp).However,DNA fragment size extracted from FFPE tissues via commercial kit was about from several hundreds to several thousands bp.The DNA yield extracted from FFPE tissues with 1% Triton X was larger than that via commercial kit.For about 500 bp fragment,four exons of EGFR could not be amplified more efficiently from extracted DNA with 1% Triton X than with commercial kit.However,for about 200 bp fragment.This simple and non-laborious protocol could successfully be used to extract DNA from FFPE tissue for the amplification of EGFR gene by PCR,further screening of EGFR gene mutation and facilitating the molecular analysis of a large number of FFPE tissues from NSCLC patients.
文摘Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far, several sufur-rich seed protein genes have been isolated and the essential amino acid contents of seed proteins were increased in transgenic tobacco and Brassica napus. In this paper we report the isolation and sequencing of the 10kd prolamin gene from seeds. Poly(A) RNA were prepared from the immature endosperms of japonica rice, Sachiminori, 10 d after flowering. Complementary DNAs were synthesized according to Promega Instruction Manual. Two primers were synthesized and their sequences were Primer Ⅰ: CGTCTACACCATCTGGAATC, Primer Ⅱ: GTGTTTGCAGATAGTATGC. The amplified fragraents were inserted into the Sma I site of pGEM-7zf(+) and was used to transform E. coli JM101 after PCR reaction. DNA sequence were determined by Sanger’s Chain-termination method. Synthesis of cDNA. Using mRNAs as
文摘Objective: To observe the expression of mouse Tbx2 gene in normal and malignant melanophore. Methods: The normal and malignant cells were used to extract total RNA. The expression of the Tbx2 gene was detected by RT-PCR. Results: No expression of the Tbx2 gene in the normal melanocytes was noted, but all malignant cells showed expression of the Tbx2 gene. Conclusion: Tbx2 plays a critical role during the development of the malignant cells.
基金Project for Outstanding Undergraduates Entering the Laboratory in Fisheries College of Guangdong Ocean UniversityNational Natural Science Foundation of China (32073015)+3 种基金Natural Science Foundation of Guangdong Province (2021A1515011078)Special Fund for Science and Technology Innovation Strategy of Guangdong Province(Scientific and Technological Innovation Cultivation of College Students)(pdjh2021b0239)Students’Platform for Innovation and Entrepreneurship Training Program of Guangdong Ocean University (CXXL2021122)Undergraduate Innovation Team Project of Guangdong Ocean University(CCTD201802)。
文摘[Objectives]To clone and analyze the TpiA gene of Vibrio alginolyticus HY9901.[Methods]According to the TpiA gene sequence of V.alginolyticus,a pair of specific primers was designed,and its full length was amplified by PCR.[Results]The full length of TpiA gene is 771 bp,encoding 256 amino acid residues in total,and the NCBI accession number is OM906798.According to the deduced amino acid sequence,its molecular weight was predicted to be about 26.97548 kDa,and its isoelectric point was 4.78.The amino acid sequence of the N-terminal signal peptide structure was predicted,and it was found that there was no obvious signal peptide cleavage site,no signal peptide,and no transmembrane region;the amino acid sequence contained 3 N-glycosylation sites,4 protein kinase C phosphorylation sites,2 casein kinase II phosphorylation sites,6 N-myristoylation sites,7 microbody C-terminal target signal site,and 1 triose phosphate isomerase active site.The prediction results of protein subcellular localization showed that TpiA may be located in mitochondria or cytoplasm,with probability of 39.1%and 34.8%,respectively.The amino acid sequence of the TpiA gene of V.alginolyticus shared 98.83%-99.61%homology with other Vibrio species,and it was clustered into the same subfamily with Vibrio parahaemolyticus and had a close relationship.In the secondary structure prediction,the proportions ofα-helix,random coil and extended chain were 44.53%,41.41%and 14.06%,respectively,and the similarity of its tertiary structure model to template 1aw1.1.A was 85.16%.[Conclusions]This study is intended to provide a basis for further research on the role of TpiA gene in the type III secretion system and related research on antibiotic resistance.
基金funded by the grants of Jilin Provincial Department of Education (2010 No. 382)Natural Science Foundation of Changchun Normal University (2010 No. 023)
文摘[Objective]To clone and identify Marek's disease virus ( MDV) serum gene. [Method]MDV genomic DNA was extracted from lymphoid tissues of the diseased chickens with latent MDV infection. The MDV L-meq gene was amplified by gradient PCR,inserted into pMD18-T vector and sequenced. The sequence was analyzed using DNAman software. [Result] The obtained sequence had 100% similarity with the published se- quence of L-meq gene,showing successful amplification of target gene. [Conclusion]The paper provides new ideas and new methods for preven- tion and treatment of Marek's disease in chickens.
基金This study was supported by grants from National Natural Science Foundation of China (No. 30772162).
文摘Aim: To investigate human epidermal growth factor receptor type 2 (HER2) protein expression and gene amplification in Chinese metastatic prostate cancer patients and their potential value as prognostic factors. Methods: Immunohistochemistry (IHC) was performed to investigate HER2 protein expression in prostate biopsy specimens from 104 Chinese metastatic prostate cancer patients. After 3-11 months of hormonal therapy, 12 patients underwent transurethral resection of the prostate (TURP). HER2 protein expression of TURP specimens was compared with that of the original biopsy specimens. Of these, 10 biopsy and 4 TURP specimens with HER2 IHC staining scores ≥ 2+ were investigated for HER2 gene amplification status by fluorescent in situ hybridization (FISH). Results: Of the 104 prostate biopsy specimens, HER2 protein expression was 0, 1+, 2+ and 3+ in 49 (47.1%), 45 (43.3%), 8 (7.7%) and 2 (1.9%) cases, respectively. There was a significant association between HER2 expression and Gleason score (P = 0.026). HER2 protein expression of prostate cancer tissues increased in 33.3% of patients after hormonal therapy. None of the 14 specimens with HER2 IHC scores 〉 2+ showed HER2 gene amplification. Patients with HER2 scores 〉 2+ had a significantly higher chance of dying from prostate cancer than those with HER2 scores of 0 (P = 0.004) and 1+ (P = 0.034). Multivariate Cox regression analysis showed that HER2 protein expression intensity was an independent predictor of cancer-related death (P = 0.039). Conclusion: An HER2 IHC score 〉 2+ should be defined as HER2 protein overexpression in prostate cancer. Overexpression of HER2 protein in cancer tissue might suggest an increased risk of dying from prostate cancer. HER2 protein expression increases in some individual patients after hormonal therapy.
文摘Objective: Angiogennesis, the formation of new blood vessels from the existing vascular bed, is essential step for growth and invasion of primary rumor. Vascular endothelial growth factor (VEGF) is known to play crucial role in tumor angiogenesis. In the present study, we investigate the expression of VEGF and VEGF-mRNA in the angiogennesis, metastasis and prognosis of lung cancer. Methods: The VEGF cellular distributions and expression in 38 specimens of patients with lung cancer were investigated with immunohistochemistry stain technology. The total RNAs in 38 tissues of lung cancer was measured, then the levels of VEGF-mRNA expression were analyzed by a reverse-transcription polymerase chain reaction (RT-PCR) assay. The levels of VEGF in sera of patients with lung cancer, benign lung diseases and healthy controls were detected through Enzyme linked immunosorbent assay (ELISA) method. Results: The VEGF positive stain was 76% in 38 cases of lung cancer specimens. The 89% rate of VEGF stain was found for clinical stage Ⅲ cases and 92% for stage Ⅳ lung cancers. The significantly higher expression of VEGF was evidenced in patients with lymph node metastasis (84%), distant metastasis (90%), and lung cancers with lower histological differentiation (89%), respectively. The expression level of total RNA was significantly higher in patients with lung cancers than that in their paracancerons or distant lung tissues. The VEGF expressions were tightly correlated with total RNA concentration of lung carcinoma ( P 〈 0.01 ). The predominant expressions of VEGF121 and VEGF165 gene fragments were found in lung cancer specimens by RT-PCR analysis. No significant difference of serum VEGF levels was detected between cases with lung cancer and patients with benign diseases. However, the VEGF level of cases with benign diseases was decreased significantly after patients with anti-inflammation medication. Conclusion: The present data suggested that the rumor tissue VEGF expression and VEGF-mRNA analysis in patients with lung cancer be a useful indicator for angiogenesis and metastasis of lung cancer.
基金supported by the National Key R&D Program of China(Grant No.2016YFC1303800)。
文摘Objective:Dysfunction in fibroblast growth factor receptor(FGFR)signaling has been reported in diverse cancer types,including non-small cell lung cancer(NSCLC).The frequency of FGFR aberrations in Chinese NSCLC patients is therefore of great clinical significance.Methods:A total of 10,966 NSCLC patients whose tumor specimen and/or circulating cell-free DNA(cf DNA)underwent hybridization capture-based next-generation sequencing were reviewed.Patients'clinical characteristics and treatment histories were also evaluated.Results:FGFR aberrations,including mutations,fusions,and gene amplifications,were detected in 1.9%(210/10,966)of the population.FGFR abnormalities were more frequently observed in lung squamous cell carcinomas(6.8%,65/954)than lung adenocarcinomas(1.3%,128/9,596).FGFR oncogenic mutations were identified in 19 patients(~0.17%),of which,68%were male lung squamous cell carcinoma patients.Eleven out of the 19 patients(58%)had concurrent altered PI3 K signaling,thus highlighting a potential combination therapeutic strategy of dual-targeting FGFR and PI3 K signaling in such patients.Furthermore,FGFR fusions retaining the intact kinase domain were identified in 12 patients(0.11%),including 9 FGFR3-TACC3,1 FGFR2-INA,1 novel FGFR4-RAPGEFL1,and 1 novel fusion between the FGFR1 and SLC20 A25′-untranslated regions,which may have caused FGFR1 overexpressions.Concomitant EGFR mutations or amplifications were observed in 6 patients,and 4 patients received anti-EGFR inhibitors,in whom FGFR fusions may have mediated resistance to anti-EGFR therapies.FGFR amplification was detected in 24 patients,with the majority being FGFR1 amplifications.Importantly,FGFR oncogenic mutations,fusions,and gene amplifications were almost always mutually exclusive events.Conclusions:We report the prevalence of FGFR anomalies in a large NSCLC population,including mutations,gene amplifications,and novel FGFR fusions.
文摘Objective: Sequencing of mouse Tbx2 gene andobserving the expression of Tbx2 gene in normal andmalignant melanophore. Methods: The PCR productsof TbX2 cDNA were cloned into PUC18 vector andsequenced. The normal and malignant melanocytes wereused to extract total RNA. The expression of Tbx2 genewas detected by RT-PCR. Results: The TbXZ genome iscomposed of seven e-cons and six nitrons. No expressionof Tbx2 gene in the normal melanocytes was noted, butall malignant melanocytes showed expression of TbXZgene. Conclusion: The observation showed the analysisof the genomic structure of mouse TbX2. TbX2 plays acritical role during the development of the malignantmelanophore.
文摘Objective: To observe the efficacy and safety of cetuximab combined with chemotherapy in advanced non-small-cell lung cancer (NSCLC), and to investigate the association of status of K-RAS gene mutation and epidermal growth factor receptor (EGFR) genotype with clinical outcome. Methods: Between Jan. 2006 and Sep. 2009, nineteen patients with advanced NSCLC received cetuximab (〉4 weeks) combined with chemotherapy in Department of Thoracic Oncology at Beijing Cancer Hospital. Response, survival and toxicity were retrospectively assessed, epidermal growth factor receptor (EGFR) protein expression was evaluated by ELISA Kit. The status of K-RAS gene mutation was tested by PCR-RFLP and EGFR gene amplification was measured by EGFR fluorescence in situ hybridization (FISH). Results: Partial response(PR) was observed in 26.3%(5/19) of the patients and stable disease(SD) in 52.6%(10/19). Median progression free survival(PFS) was 6 months (95% CI: 3.6-8.4). Median overall survival (MST) and 1-year survival rate(SR) were 10.6 months (95% CI: 6.6-14.6) and 47.6%, respectively. Mild or moderate skin rash was the most common toxicity related with cetuximab. K-RAS gene mutation, EGFR protein level and amplification have little correlation with prognosis. Conclusion: Cetuximab combined with chemotherapy was tolerable and the skin rash related with cetuximab was mild to moderate. Cetuximab may prolong survival of the patients who failed to previous chemotherapy.
文摘Human vascular endothelial growth factor cDNA was amplified by nested polymerase chain reaction method from the HL60 cells. Then a pCD hVEGF 165 recombinant plasmid was constructed. Rabbit osteoblasts were transfected with pCD hVEGF 165 plasmid by lipofectin mediated gene transfer. The transient expressive results were detected by immunohistochemical method. It was observed that the expression of human VEGF gene was detected 72 h after transfecting distinctly.
基金supported by the National Key Research and Development Program of China (2021YFC2100600)the National Natural Science Foundation of China (30970072 and 31170088)+1 种基金Biological Resources ProgrammeChinese Academy of Sciences (KFJBRP-009)。
文摘Amplification of biosynthetic gene clusters is important to increase secondary metabolite production.However,the copy number of amplified gene clusters is difficult to control precisely.In this study,the tandem amplification of a 70 kb bleomycin biosynthetic gene cluster was precisely regulated through the combined strategy of a Zou A-dependent DNA amplification system and double-reporter-guided recombinant selection in Streptomyces verticillus ATCC15003.The production of bleomycin in the recombinant strain containing six copies of the bleomycin gene cluster was 9.59-fold higher than that in the wild-type strain.The combined strategy used in this study is powerful and applicable for precisely regulating the amplification of gene clusters and improving the corresponding secondary metabolite production.
文摘Background Targeted tumor therapies have been making rapid progress in recent years, and the erbB-2 oncogene is a suitable target. There was much discussion about the level of erbB-2 in osteosarcoma. The aim of this study was to investigate the erbB-2 amplification or expression status in osteosarcoma. Methods Fluorescence in situ hybridization (FISH) and DNA probes for erbB-2 and centromere 17 were used to examine the erbB-2 gene amplification status in 32 osteosarcoma samples, and expression of erbB-2 was analyzed by immunohistochemistry (IHC) and reverse transcription-polymerase chain reaction (RT-PCR). Results None of the 32 osteosarcomas was observed by FISH to have the erbB-2 gene amplified, and no distinguishable membrane staining was seen in any case yet, nevertheless, erbB-2 overexpression was present in 6 tumor samples by RT-PCR. Conclusions The status of erbB-2 gene amplification and membrane overexpression is rare in osteosarcomas, and might suggest that the erbB-2 target agent should not be applied to osteosarcomas as single treatment.
文摘Background Clinical programs for preventing β-thalassemia are presently based on prospective carrier screening and prenatal diagnosis. This paper report an achievement of a pregnancy with unaffected embryos using in vitro fertilization and embryo transfer (IVF-ET), in combination with preimplantation genetic diagnosis (PGD), for a couple at risk of having children with β-thalassemia. Methods A couple carrying different thalassemia mutations, both a codon 41-42 mutation and the IVS-II-654 mutation, received standard IVF treatment, with intracytoplasmic sperm injection, embryo biopsiy, single cell polymerase chain reaction (PCR) and DNA analysis. Only unaffected or carrier embryos were transferred to the uterine cavity. After confirmation of pregnancy, a prenatal diagnosis was performed. Results Of a total of 13 embryos analyzed for β-globin mutations, PGD indicated that 2 were normal, 3 were affected, and 6 were carriers. Diagnosis could not be made in the other 2 embryos. Three embryos were transferred to the uterus on the third day after oocyte retrieval. Ultrasonography revealed a twin pregnancy with one blighted ovum. The prenatal genetic diagnosis revealed that both fetuses were unaffected, and two healthy boys were born, confirming the results of PGD. Conclusions We developed a single-cell based primer extension preamplification (PEP)-PCR assay for the detection of β-thalassemia mutations. The assays were efficient and accurate at all stages of the procedure, and resulted in the birth of PGD-confirmed β-thalassemia free children in China. PEP was used here in PGD for β-thalassemia.