Gene Sequence, Soluble Expression and Homologous Comparison of a D-Hydantoinase fromPseudomonas putida YZ-26

A 1440bp open-reading frame encoding D-hydantoinase from Pseudomonas putida YZ-26 was cloned and sequenced（ GenBank AY387829）. The DNA fragment was inserted into Nde and BamHI sites of vector pET-3a, yielding a recombinant plasmid, pET-HDT. After being transferred into the host strain, the artificial strain, pET-HDT/ E. coli BL21 can express the D-hydantoinase as the soluble form in the Lura-Bertani medium without addition of any inducers. The activity of the enzyme toward substrate DL-hydantoin can reach 3000-4000 IU per cells from one-liter bacterial culture incubated at 30 ℃ for 10-12 h. By the comparison of amino acid sequence homology, hydrophobic residues analysis and secondary structure prediction, it was found that D-hydantoinase reported herein is quite similar to that from Pseudomonas putdia CCRC12857, and alike to that from Pseudomonas putdia DSM84 or other bacteria. A rapid and efficient purification procedure of the enzyme was performed by a three-step procedure： ammonium sulfate fractionation, phenyl Sepharose hydrophobic interaction chromatography and Sephacryl S-200 gel filtration. The molecular mass of the monomeric enzyme is 52042 Da as determined by MALDI-TOF mass spectrometry.

On four closely related hypotrichous ciliates(Protozoa,Ciliophora,Spirotrichea):molecular characters,interspecific relationships and phylogeny defined with multigene sequence information

In order to clarify the phylogeny and relationships of the most confused hypotrichous ciliates,Holosticha-complex,four closely related holostichids（five populations）,Holosticha bradburyae,H.diademata,Anteholosticha sp.,and A.manca,were compared and analyzed using ITS2 secondary structures,ITS1-5.8S-ITS2 region and SSrRNA gene sequences.The ITS1-5.8S-ITS2 region sequences of these four species were first sequenced,and they shared sequence identities ranging from 68.0% to 90.1%,while two populations of Anteholosticha sp.differed in three nucleotides（sequence identity 99.8%）.There were several minor differences among ITS2 secondary structures of these species,while two populations of Anteholosticha sp.had the identical secondary structure.Phylogenetic trees inferred from the ITS1-5.8S-ITS2 region sequences of stichotrichs using multiple algorithms（Neighbor-Joining,Maximum Parsimony and Bayesian） revealed similar topologies.The results show that：（1） Holosticha bradburyae and H.diademata firmly clustered together with strong bootstrap supports,forming a sister clade with Anteholosticha sp.,（2） Anteholosticha appeared to be a paraphyletic assemblage,in which the morphotype A.manca was more closely related to Diaxonella trimarginata than to its congener Anteholosticha sp.Phylogenetic analyses based on the SSrRNA gene and the combined sequences of SSrRNA gene and ITS1-5.8S-ITS2 region revealed the similar relationships between Holosticha and Anteholosticha,nevertheless their positions within the subclass Stichotrichia differed from each other inferred from different genes.

Infer HIV transmission dynamics from gene sequences among young men who have sex with men in China

To investigate the transmission dynamics and temporal and spatial migration characteristics of HIV spread among men who have sex with men(MSM)in China,a total of 1012 HIV-1 partial pol sequences,including five subtypes,were studied.Bayesian analysis were applied for each subtype to infer its dynamic characters including the effective reproductive number(R_(e))and migration process.The mean curve of each R_(e) was almost always greater than 1(even the 95%highest posterior density(HPD)lower value)along with time,which supports the necessity for a comprehensive study about risk behaviors among young MSM group in China.We also should reappraise the free treatment strategy,especially the therapeutic effect during the free treatment policy.

Nucleotide Sequence of Polyhedrin Gene of LsNPV and Analysis of Baculovirus Polyhedron Proteins

The intact 741 hp polyhedrin gene of LsNPV was sequenced by Silver Sequencing System, and shares 90.6% and 97.0% nucleotide identity, 97.2% and 97. 6% amino acid identity with PfNPV and MdNPV polh genes respectively. The 14 hp conservative sequence with the core element GTAAG,is located in the 5'untranslated region of the gene. The polh gene was predicted to encodes a 246 amino sold residures with molecular weight of 29.0 kd, in which the number of acidic amino acids and alkaline amino acids was roughly equal resulting in almost no charges in polyhedrin protein molecule and hence occlusion body. It gives a valuable implication that ionic bonds as well as hydrophobic bonds and hydrogen bond may Play an important role in the crystallization or polyhedrin, by comparing amino acid variation of twenty-one polyhedrin. The comparison of promoter regions of polyhedrin gene and class Ⅲ gene shown that they are very similar, but also have differences in GC content.This could explain that both categories of gene are highly expressed, and polyhedrin genes are expressed more higher than class Ⅲ gene.

Social Robot Detection Method with Improved Graph Neural Networks

Social robot accounts controlled by artificial intelligence or humans are active in social networks,bringing negative impacts to network security and social life.Existing social robot detection methods based on graph neural networks suffer from the problem of many social network nodes and complex relationships,which makes it difficult to accurately describe the difference between the topological relations of nodes,resulting in low detection accuracy of social robots.This paper proposes a social robot detection method with the use of an improved neural network.First,social relationship subgraphs are constructed by leveraging the user’s social network to disentangle intricate social relationships effectively.Then,a linear modulated graph attention residual network model is devised to extract the node and network topology features of the social relation subgraph,thereby generating comprehensive social relation subgraph features,and the feature-wise linear modulation module of the model can better learn the differences between the nodes.Next,user text content and behavioral gene sequences are extracted to construct social behavioral features combined with the social relationship subgraph features.Finally,social robots can be more accurately identified by combining user behavioral and relationship features.By carrying out experimental studies based on the publicly available datasets TwiBot-20 and Cresci-15,the suggested method’s detection accuracies can achieve 86.73%and 97.86%,respectively.Compared with the existing mainstream approaches,the accuracy of the proposed method is 2.2%and 1.35%higher on the two datasets.The results show that the method proposed in this paper can effectively detect social robots and maintain a healthy ecological environment of social networks.

Impact of Different Rates of Nitrogen Supplementation on Soil PhysicochemicalProperties and Microbial Diversity in Goji Berry

Goji berry(Lycium barbarum L.)is substantially dependent on nitrogen fertilizer application,which can signifi-cantly enhance fruit yield and Goji berry industrial development in Ningxia,China.This study aimed to analyze the functions of differential nitrogen application rates including low(N1),medium(N2),and high(N3)levels in soil microbial community structure(bacterial and fungal)at 2 diverse soil depths(0-20,20-40 cm)through high-throughput sequencing technology by targeting 16S RNA gene and ITS1&ITS2 regions.All the observed physicochemical parameters exhibited significant improvement(p<0.05)with increased levels of nitrogen and the highest values for most parameters were observed at N2.However,pH decreased(p<0.05)gradually.The alpha and beta diversity analyses for bacterial and fungal communities’metagenome displayed more similarities than differences among all groups.The top bacterial and fungal phyla and genera suggested no obvious(p>0.05)differences among three group treatments(N1,N2,and N3).Furthermore,the functional enrichment analysis demonstrated significant(p<0.05)enrichment of quorum sensing,cysteine and methionine metabolism,and transcriptional machinery for bacterial communities,while various saprotrophic functional roles for fungal communities.Conclusively,moderately reducing the use of N-supplemented fertilizers is conducive to increasing soil nitrogen utilization rate,which can contribute to sustainable agriculture practices through improved soil quality,and microbial community structure and functions.

Methotrexate combined with methylprednisolone for the recovery of motor function and differential gene expression in rats with spinal cord injury

Methylprednisolone is a commonly used drug for the treatment of spinal cord injury, but high doses of methylprednisolone can increase the incidence of infectious diseases. Methotrexate has anti-inflammatory activity and immunosuppressive effects, and can reduce in- flammation after spinal cord injury. To analyze gene expression changes and the molecular mechanism of methotrexate combined with methylprednisolone in the treatment of spinal cord injury, a rat model of spinal cord contusion was prepared using the PinPointTM preci- sion cortical impactor technique. Rats were injected with methylprednisolone 30 mg/kg 30 minutes after injury, and then subcutaneously injected with 0.3 mg/kg methotrexate 1 day after injury, once a day, for 2 weeks. TreadScan gait analysis found that at 4 and 8 weeks after injury, methotrexate combined with methylprednisolone significantly improved hind limb swing time, stride time, minimum longitudinal deviation, instant speed, footprint area and regularity index. Solexa high-throughput sequencing was used to analyze differential gene ex- pression. Compared with methylprednisolone alone, differential expression of 316 genes was detected in injured spinal cord treated with methotrexate and methylprednisolone. The 275 up-regulated genes were mainly related to nerve recovery, anti-oxidative, anti-inflammatory and anti-apoptotic functions, while 41 down-regulated genes were mainly related to proinflammatory and pro-apoptotic functions. These results indicate that methotrexate combined with methylprednisolone exhibited better effects on inhibiting the activity of inflammatory cytokines and enhancing antioxidant and anti-apoptotic effects and thereby produced stronger neuroprotective effects than methotrexate alone. The 316 differentially expressed genes play an important role in the above processes.

Inherited Genetic Susceptibility to Nonimmunosuppressed Epstein-Barr Virus-associated T/NK-cell Lymphoproliferative Diseases in Chinese Patients

Epstein-Barr virus(EBV)T/NK-cell lymphoproliferative diseases are characterized by clonal expansion of EBV-infected T or NK cells,including chronic active EBV infection of T/NK-cell type(CAEBVT/NK),EBV-associated hemophagocytic lymphohistiocytosis(EBV HLH),extranodal NK/T-cell lymphoma of nasal type(ENKTL),and aggressive NK-cell leukemia(ANKL).However,the role of inherited genetic variants to EBV+T/NK-LPDs susceptibility is still unknown.A total of 171 nonimmunosuppressed patients with EBV T/NK-LPDs and 104 healthy donors were retrospectively collected and a targeted sequencing study covering 15 genes associated with lymphocyte cytotoxicity was performed.The 94 gene variants,mostly located in UNCI 3D,LYST,ITK,and PRF1 genes were detected,and mutations covered 28/50(56.00%)of CAEBV-T/NK,31/51(60.78%)of EBV HLH,13/28(46.42%)of ENKTL,and 13/48(27.09%)of ANKL.Most mutations represented monoallelic and missense.Three-year overall survival rate of patients with CAEBV-T/NK and EBV+HLH was significantly lower in patients with germline mutations than in those without germline mutations(P=0.0284,P=0.0137).Our study provided novel insights into understanding a spectrum of nonimmunosuppressed EBV*T/NK-LPDs with respect to genetic defects associated with lymphocyte cytotoxicity and reminded us that the gene sequencing may be an auxiliary test for diagnosis and risk stratification of EBV+T/NK-LPDs.

Proteolipid protein 1 gene sequencing of hereditary spastic paraplegia

PCR amplification and sequencing of whole blood DNA from an individual with hereditary spastic paraplegia, as well as family members, revealed a fragment of proteolipid protein 1 （PLP1） gene exon 1, which excluded the possibility of isomer 1 expression for this family. The fragment sequence of exon 3 and exon 5 was consistent with the proteolipid protein 1 sequence at NCBI. In the proband samples, a PLP1 point mutation in exon 4 was detected at the basic group of position 844, T→C, phenylalanine→leucine. In proband samples from a male cousin, the basic group at position 844 was C, but gene sequencing signals revealed mixed signals of T and C, indicating possible mutation at this locus. Results demonstrated that changes in PLP1 exon 4 amino acids were associated with onset of hereditary spastic paraplegia.

Correlation between ECT2 gene expression and methylation change of ECT2 promoter region in pancreatic cancer

BACKGROUND: Pancreatic cancer is closely related to epigenetic abnormality. The epithelial cell transforming sequence 2 gene (ECT2) plays a critical role in Rho activation during cytokinesis, and thus may play a role in the pathogenesis of pancreatic cancer. In this study, we investigated the relationships between aberrant expression and epigenetic changes of the ECT2 gene in pancreatic cancer. METHODS: Four cell lines (PANC-1, Colo357, T3M-4 and PancTu I) and pancreatic ductal adenocarcinoma (PDAC) tissues were used for mRNA detection. After restriction isoschizomer endonucleases (Msp I/Hpa II) were used to digest the DNA sequence (5'-CCGG-3'), PCR was made to amplify the product. And RT-PCR was applied to determine the expression of the gene. RESULTS: The mRNA expression of the ECT2 gene was higher in pancreatic tumor tissue than in normal tissue. The gene was also expressed in the 4 PDAC cell lines. The methylation states of the upstream regions of the ECT2 gene were almost identical in normal, tumor pancreatic tissues, and the 4 PDAC cell lines. Some of the 5'-CCGG-3' areas in the upstream region of ECT2 were methylated, while others were unmethylated. CONCLUSIONS: The oncogene ECT2 is overexpressed in pancreatic tumor tissues as verified by RT-PCR detection. The methylation status of DNA in promoter areas is involved in the gene expression, along with other factors, in pancreatic cancer.

Polymorphic Analysis of TLR2 Gene in Native Hainan Pig Breeds Based on Sequencing Technology

[Objective]The paper was to understand the polymorphism of TLR2 gene in native Hainan pig breeds.[Method]TLR2 gene were cloned from blood samples of Wuzhishan pigs,Lingao pigs and Tunchang pigs by PCR and sequenced.[Result]The DNA sequence of TLR2 gene in native Hainan pig breeds was 2649 bp and its CDS was 2358 bp.The intra-specific alignment of TLR2 gene sequences of the three pigs showed that there were seven nucleotide polymorphisms in Wuzhishan pigs(two of which located in the coding region),five nucleotide polymorphisms in Tunchang pigs(all of which were outside the coding region)and four nucleotide polymorphisms in Lingao pigs(one of which was located in the coding region).The results of inter-specific comparison showed that there were 12 nucleotide polymorphisms in three pig breeds,three of polymorphisms were missense mutations,resulting in changes in amino acids.The results of homologous analysis showed that the TLR2 gene sequences of the three pig breeds were highly conservative,with the homology ranging from 99.6% to 99.9%.Prediction and analysis of protein structure showed that AG mutation at 876 and 1454 sites of TLR2 gene in native Hainan pigs caused changes in secondary and tertiary structure of the protein,suggesting there might be possible changes in the function of TLR2.[Conclusion]The study provided reference for further research on the relationship between polymorphism of TLR2 gene and epidemic susceptibility of pigs.

The Genetic Structure and Diversity of Repomucenus curvicornis Inhabiting Liaoning Coast Based on Mitochondrial COⅠ Gene and Control Region

[Object] This study was conducted to explore the genetic diversity and structure of the wild Repomucenus curvicornis inhabiting Liaoning Coast, China. [Method] The mitochondrial COⅠ gene and control region（CR） were PCR amplified from the wild R. curvicornis populations from the Liaodong Bay（n=22） and the northern Yellow Sea（n=18）, sequenced and analyzed for genetic diversity. [Result] The contents of A, T, C and G of 624 bp COⅠ gene were 24.09%, 31.04%, 25.28%, and 19.59%, and those of 460 bp CR fragment were 32.96%, 32.80%, 14.86% and 19.38%, respectively. The total number of variable sites, average number of nucleotide differences（ k）, haplotype diversity（H） and nucleotide diversity（π） based on COⅠ gene were 38, 4.67,（0.96±0.02） and（0.007 5±0.004 2）, and those based on CR fragment were 26, 3.35,（0.97 ±0.02） and（0.007 3±0.004 3）, respectively. Based on mitochondrial COⅠ gene and CR, the genetic diversity of Liaodong Bay population was lower than that of the northern Yellow Sea population. The AMOVA analysis based on CR fragments revealed almost significant genetic divergence between the Liaodong Bay and the northern Yellow Sea populations, while there was no significant genetic divergence based on COⅠ gene. The results showed that CR and COⅠ gene are effective molecular markers for detecting the genetic diversity of R. curvicornis population, while CR is more reliable than COⅠ gene in detecting the genetic structure. [Conclusion] CR is an appropriate marker for genetic analysis of marine fish population.

Amplification and sequencing of a sulfur-rich 10kd prolamin gene from rice seeds

Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far, several sufur-rich seed protein genes have been isolated and the essential amino acid contents of seed proteins were increased in transgenic tobacco and Brassica napus. In this paper we report the isolation and sequencing of the 10kd prolamin gene from seeds. Poly(A) RNA were prepared from the immature endosperms of japonica rice, Sachiminori, 10 d after flowering. Complementary DNAs were synthesized according to Promega Instruction Manual. Two primers were synthesized and their sequences were Primer Ⅰ: CGTCTACACCATCTGGAATC, Primer Ⅱ: GTGTTTGCAGATAGTATGC. The amplified fragraents were inserted into the Sma I site of pGEM-7zf(+) and was used to transform E. coli JM101 after PCR reaction. DNA sequence were determined by Sanger’s Chain-termination method. Synthesis of cDNA. Using mRNAs as

Alterations in gut microbiota are related to metabolite profiles in spinal cord injury

Studies have shown that gut microbiota metabolites can enter the central nervous system via the blood-spinal cord barrier and cause neuroinflammation, thus constituting secondary injury after spinal cord injury. To investigate the correlation between gut microbiota and metabolites and the possible mechanism underlying the effects of gut microbiota on secondary injury after spinal cord injury, in this study, we established mouse models of T8–T10 traumatic spinal cord injury. We used 16 S rRNA gene amplicon sequencing and metabolomics to reveal the changes in gut microbiota and metabolites in fecal samples from the mouse model. Results showed a severe gut microbiota disturbance after spinal cord injury, which included marked increases in pro-inflammatory bacteria, such as Shigella, Bacteroides, Rikenella, Staphylococcus, and Mucispirillum and decreases in anti-inflammatory bacteria, such as Lactobacillus, Allobaculum, and Sutterella. Meanwhile, we identified 27 metabolites that decreased and 320 metabolites that increased in the injured spinal cord. Combined with pathway enrichment analysis, five markedly differential amino acids(L-leucine, L-methionine, L-phenylalanine, L-isoleucine and L-valine) were screened out, which play a pivotal role in activating oxidative stress and inflammatory responses following spinal cord injury. Integrated correlation analysis indicated that the alteration of gut microbiota was related to the differences in amino acids, which suggests that disturbances in gut microbiota might participate in the secondary injury through the accumulation of partial metabolites that activate oxidative stress and inflammatory responses. Findings from this study provide a new theoretical basis for improving the secondary injury after spinal cord injury through fecal microbial transplantation.

Sarcopenia and gut microbiota alterations in patients with hematological diseases before and after hematopoietic stem cell transplantation

Objective: The aim of this study was to investigate the prevalence of sarcopenia(SP) and its relationship with gut microbiota alterations in patients with hematological diseases before and after hematopoietic stem cell transplantation(HSCT).Methods: A total of 108 patients with various hematological disorders were selected from Peking University People’s Hospital. SP was screened and diagnosed based on the 2019 Asian Sarcopenia Diagnosis Strategy. Physical measurements and fecal samples were collected, and 16S rRNA gene sequencing was conducted. Alpha and beta diversity analyses were performed to evaluate gut microbiota composition and diversity.Results: After HSCT, significant decreases in calf circumference and body mass index(BMI) were observed,accompanied by a decline in physical function. Gut microbiota analyses revealed significant differences in the relative abundance of Enterococcus, Bacteroides, Blautia and Dorea species before and after HSCT(P<0.05). Before HSCT, sarcopenic patients had lower Dorea levels and higher Phascolarctobacterium levels than non-sarcopenia patients(P<0.01). After HSCT, no significant differences in species abundance were observed. Alpha diversity analysis showed significant differences in species diversity among the groups, with the highest diversity in the postHSCT 90-day group and the lowest in the post-HSCT 30-day group. Beta diversity analysis revealed significant differences in species composition between pre-and post-HSCT time points but not between SP groups. Linear discriminant analysis effect size(LEfSe) identified Alistipes, Rikenellaceae, Alistipes putredinis, Prevotellaceae defectiva and Blautia coccoides as biomarkers for the pre-HSCT sarcopenia group. Functional predictions showed significant differences in anaerobic, biofilm-forming and oxidative stress-tolerant functions among the groups(P<0.05).Conclusions: This study demonstrated a significant decline in physical function after HSCT and identified potential gut microbiota biomarkers and functional alterations associated with SP in patients with hematological disorders. Further research is needed to explore the underlying mechanisms and potential therapeutic targets.

Inherited CHEK2 p.H371Y mutation in solitary rectal ulcer syndrome among familial patients:A case report

BACKGROUND Solitary rectal ulcer syndrome(SRUS)is a rare rectal disease with unknown etiology.Data on the genetic background in SRUS is lacking.CASE SUMMARY Here,we report the first case of SRUS in a mother-son relationship.Gene sequencing was conducted on the whole family,which revealed an inherited CHEK2 p.H371Y mutation.The experiment preliminarily revealed that the CHEK2 mutation did not affect the expression of CHEK2 protein,but affected the function of CHEK2,resulting in the expression level changes of downstream genes such as CDC25A.CONCLUSION SRUS is a genetic susceptibility disease where CHEK2 p.H371Y mutation may play a crucial role in the development and prognosis of SRUS.

Hidrotic ectodermal dysplasia in a Chinese pedigree:A case report

BACKGROUND We report on a large family of Chinese Han individuals with hidrotic ectodermal dysplasia(HED)with a variation in GJB6(c.31G>A).The patients in the family had a triad of clinical manifestations of varying degrees.Although the same variation locus have been reported,the clinical manifestations of this family were difficult to distinguish from those of congenital thick nail disorder,palmoplantar keratosis,and congenital hypotrichosis.CASE SUMMARY This investigation involved a large Chinese family of 46 members across five generations and included 12 patients with HED.The proband(IV4)was a male patient with normal sweat gland function and dental development,no skeletal dysplasia,no cognitive disability,and no hearing impairments.His parents were not consanguineously married.Physical examination of the proband revealed thinning hair and thickened grayish-yellow nails and toenails with some longit-udinal ridges,in addition to mild bilateral palmoplantar hyperkeratosis.GJB6,GJB2,and GJA1 have been reported to be the causative genes of HED;therefore,we subjected the patient’s samples to Sanger sequencing of these three genes.In this family,the variation locus was at GJB6(c.31G>A,p.Gly11Arg).Overex-pression vectors of wild-type GJB6 and its variants were established and transfected into HaCaT cell models,and the related mRNA and protein expression changes were determined using real-time reverse transcriptase-polymerase chain reaction and Western blot,respectively.CONCLUSION We report another HED phenotype associated with GJB6 variations,which can help clinicians to diagnose HED despite its varying presentations.

Ratio of hemoglobin to mean corpuscular volume: A new index for discriminating between iron deficiency anemia and thalassemia trait

BACKGROUND Iron deficiency anemia(IDA)and thalassemia trait(TT)are the most common microcytic and hypochromic anemias.Differentiation between mild TT and early IDA is still a clinical challenge.AIM To develop and validate a new index for discriminating between IDA and TT.METHODS Blood count data from 126 patients,consisting of 43 TT patients and 83 IDA pa-tients,was retrospectively analyzed to develop a new index formula.This formula was further validated in another 61 patients,consisting of 48 TT patients and 13 IDA patients.RESULTS The new index is the ratio of hemoglobin to mean corpuscular volume.Its sen-sitivity,specificity,accuracy,Youden’s Index,area under the receiver operating characteristic curve,and Kappa coefficient in discriminating between IDA and TT were 93.5%,78.4%,83.3%,0.72,0.97,and 0.65,respectively.CONCLUSION This new index has good diagnostic performance in discriminating between mild TT and early IDA.It requires only two results of complete blood count,which can be a very desirable feature in under-resourced scenarios.