Highly specific selenium nanosystems for fluorescent image-guided rapid diagnosis and pathological grading of ovarian malignant tumors

Comprehensive surgical staging or optimal tumor cytoreductive surgery of malignant ovarian cancer directly affects disease prognosis.Therefore,a fluorescent selenium nanoparticle(Se@RGD/S2.2)decorated with cancer-targeting Arg-Gly-Asp(RGD)peptides and GCAGTTGATCCTTTGGATACCCTGG aptamer(S2.2)was developed for use as a diagnostic agent to achieve rapid,noninvasive diagnosis and visualization of microinvasive lesions during surgery for malignant ovarian cancer.

Factors associated with gastrointestinal stromal tumor rupture and pathological risk:A single-center retrospective study

BACKGROUND Gastrointestinal stromal tumor(GIST)is a rare gastrointestinal mesenchymal tumor with potential malignancy.Once the tumor ruptures,regardless of tumor size and mitotic number,it can be identified into a high-risk group.It is of great significance for the diagnosis,treatment,and prognosis of GIST if non-invasive examination can be performed before surgery to accurately assess the risk of tumor.AIM To identify the factors associated with GIST rupture and pathological risk.METHODS A cohort of 50 patients with GISTs,as confirmed by postoperative pathology,was selected from our hospital.Clinicopathological and computed tomography data of the patients were collected.Logistic regression analysis was used to evaluate factors associated with GIST rupture and pathological risk grade.RESULTS Pathological risk grade,tumor diameter,tumor morphology,internal necrosis,gas-liquid interface,and Ki-67 index exhibited significant associations with GIST rupture(P<0.05).Gender,tumor diameter,tumor rupture,and Ki-67 index were found to be correlated with pathological risk grade of GIST(P<0.05).Multifactorial logistic regression analysis revealed that male gender and tumor diameter≥10 cm were independent predictors of a high pathological risk grade of GIST[odds ratio(OR)=11.12,95%confidence interval(95%CI):1.81-68.52,P=0.01;OR=22.96,95%CI:2.19-240.93,P=0.01].Tumor diameter≥10 cm,irregular shape,internal necrosis,gas-liquid interface,and Ki-67 index≥10 were identified as independent predictors of a high risk of GIST rupture(OR=9.67,95%CI:2.15-43.56,P=0.01;OR=35.44,95%CI:4.01-313.38,P<0.01;OR=18.75,95%CI:3.40-103.34,P<0.01;OR=27.00,95%CI:3.10-235.02,P<0.01;OR=4.43,95%CI:1.10-17.92,P=0.04).CONCLUSION Tumor diameter,tumor morphology,internal necrosis,gas-liquid,and Ki-67 index are associated with GIST rupture,while gender and tumor diameter are linked to the pathological risk of GIST.These findings contribute to our understanding of GIST and may inform non-invasive examination strategies and risk assessment for this condition.

Application of intravoxel incoherent motion diffusion-weighted imaging in hepatocellular carcinoma

The morbidity and mortality of hepatocellular carcinoma(HCC)rank 6th and 4th,respectively,among malignant tumors worldwide.Traditional diffusion-weighted imaging(DWI)uses the apparent diffusion coefficient(ADC)obtained by applying the monoexponential model to reflect water molecule diffusion in active tissue;however,the value of ADC is affected by microcirculation perfusion.Using a biexponential model,intravoxel incoherent motion(IVIM)-DWI quantitatively measures information related to pure water molecule diffusion and microcirculation perfusion,thus compensating for the shortcomings of DWI.The number of studies examining the application of IVIM-DWI in patients with HCC has gradually increased over the last few years,and many results show that IVIMDWI has vital value for HCC differentiation,pathological grading,and predicting and evaluating the treatment response.The present study principally reviews the principle of IVIM-DWI and its research progress in HCC differentiation,pathological grading,predicting and evaluating the treatment response,predicting postoperative recurrence and predicting gene expression prediction.

Abnormal expressions of proliferating cell nuclear antigen and P27 protein in brain glioma

Both proliferating cell nuclear antigen and P27 protein are important factors to regulate cell cycle. While, the combination of them can provide exactly objective markers to evaluate prognosis of patients with brain glioma needs to be further studied based on pathological level. OBJECTIVE： To observe the expressions of proliferating cell nuclear antigen and P27 protein in both injured and normal brain glioma tissues and analyze the effect of them on onset and development of brain glioma. DESIGN： Case contrast observation. SETTING： Department of Neurosurgery, the Second Affiliated Hospital of Xi＇an Jiaotong University. PARTICIPANTS： A total of 63 patients with brain glioma were selected from Department of Neurosurgery, the Second Affiliated Hospital of Xi＇an Jiaotong University from July 1996 to June 2000. There were 38 males and 25 females and their ages ranged from 23 to 71 years. Based on pathological classification and grading standards of brain glioma, patients were divided into grade I - II （n=30） and grade III- IV （n = 33）. All cases received one operation but no radiotherapy and chemiotherapy before operation. Sample tissues were collected from tumor parenchyma. Non-neoplastic brain tissues were collected from another 12 non-tumor subjects who received craniocerebral trauma infra-decompression and regarded as the control group. There were l0 males and 2 females and their ages ranged from 16 to 54 years. The experiment had got confirmed consent from local ethic committee and the collection was provided confirmed consent from patients and their relatives. All samples were restained with HE staining so as to diagnose as the brain glioma. While, all patients with brain glioma received radiotherapy after operation and their survival periods were followed up. METHODS： Primary lesion wax of brain glioma was cut into serial sections and stained with S-P immunohistochemical staining. Brown substance which was observed in tumor nucleus was regarded as the positive expressions of both proliferating cell nuclear antigen and P27 protein. Automatic imaging analytic system was used to quantitatively analyze staining results of tumor. MAIN OUTCOME MEASURES： To compare the expressions of proliferating cell nuclear antigen and P27 protein in brain glioma tissues and non-tumor brain tissues and investigate the effect of various sexes, ages, survival periods and severities on the expressions of them in brain tissues. RESULTS： There was no significant difference of sexes and ages in the expressions of proliferating cell nuclear antigen and P27 protein （P 〉 0.05）; however, the expressions of proliferating cell nuclear antigen and P27 protein were milder in non-tumor brain tissues than those in the brain glioma tissues （P 〈 0.05）. Expression of proliferating cell nuclear antigen in brain tissue of grade III- IV severity was stronger than that of grade I - II severity, and the expression in ≥ 5-year survival periods were also stronger than that in 〈 5-year survival periods （P 〈 0.05）. In addition, expression of P27 protein in brain tissue of grade III- IV severity was stronger than that of grade I - II severity, and the expression in ≥ 5-year survival periods were also stronger than that in 〈 5-year survival periods （P 〈 0.05）. CONCLUSION： Abnormal expressions of proliferating cell nuclear antigen and P27 protein in human brain glioma are closely related to onset, development and prognosis of tumor.

Predictive efficacy of the 2014 International Society of Urological Pathology Gleason grading system in initially diagnosed metastatic prostate cancer

We compared the predictive ability of the 2014 and 2005 Gleason grading systems in 568 patients initially diagnosed with metastatic prostate cancer （PCa）. Outcomes included the duration of castration-resistant prostate cancer-free survival （CFS） and overall survival （OS）. Univariate analyses and log-rank tests were used to identify prognosis indicators and assess univariable differences in CFS and OS in Gleason score （GS） groups. Cox proportional hazards and area under the curves of receiver operator characteristics methods were used to evaluate the predictive efficacy of the 2005 and 2014 ISUP grading systems. Univariate analyses showed that the 2005 and 2014 grading systems were prognosticators for CFS and OS; both systems could distinguish the clinical outcome of patients with GS 6, GS 7, and GS 8-10. Using the 2014 criteria, no statistical differences in patient survival were observed between GS 3 ＋ 4 and GS 4 ＋ 3 or GS 8 and GS 9-10. The predictive ability of the 2014 and 2005 grading systems was comparable for CFS and OS （P = 0.321）. However, the 2014 grading system did not exhibit superior predictive efficacy in patients initially diagnosed with PCa and bone metastasis; trials using larger cohorts are required to confirm its predictive value. To the best of our knowledge, ours is the first study to compare the 2005 and 2014 grading systems in initially diagnosed PCa with bone metastasis. At present, we recommend that both systems should be used to predict the prognosis of patients with metastatic PCa.

Designing DNA cage-based immuno-fluorescence strategy for rapid diagnosis of clinical cervical cancer tissues

Exploiting a tissue diagnosis method to abstain the involuted operating and consume valuable reagents while realizing high-speed and inexpensive pathological grading technology to supply a better scheme for cancer therapy is a significant method of cancers detection. A promising immuno-fluorescence strategy was rationally designed and synthesized by loading ruthenium complex into cervical cancer-targeted DNA-cage, which was well used to realize high-speed and inexpensive diagnosis of clinical cervical cancer tumor tissues avoiding the traditional multi-stage process, thus demonstrating high application potential in clinical pathological grading and surgical judgment. Moreover, it has been finding that Apts-DNA@Ru can enrichment in the tumor region, interestingly, no enrichment in normal cervical cancer tissue. It has the potential to realize the integration of in vivo diagnose and further synchronous treatment in the near future. Thence, this study demonstrates a strategy for integration of cancer-targeted DNA-cage and fluorescent Ru POP as alternative IHC reagents for next-generation more rapid convenient cancer detection.