The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the prese...The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.展开更多
In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondri...In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.展开更多
Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA...Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.展开更多
Plant RNA N-glycosidase specifically hydrolyzes the N-C glycosidic bond of a conserved adenosine in the sarcin/ricin domain of the largest RNA in ribosome, releasing an adenine base and thus inhibiting protein synthes...Plant RNA N-glycosidase specifically hydrolyzes the N-C glycosidic bond of a conserved adenosine in the sarcin/ricin domain of the largest RNA in ribosome, releasing an adenine base and thus inhibiting protein synthesis. This substrate specificity was challenged later by discovery that various RNA derivatives and DNAs, especially the double-stranded supercoiled DNA could be used as substrate by RNA N-glycosidase. Thus, it was argued whether the DNA-cleaving activity was an intrinsic feature of RNA N-glycosidase or it was contaminated by DNase. In this article, several lines of evidence are presented to show that RNA N-glycosidase can really release the adenine base from the double-stranded supercoi/ed DNA. It was proposed that the cleavage mechanism of supercoiled DNA was the phosphodiester bonds in enzymatically deadenylated regions of the supercoiled DNA would become fragile and liable to produce nicked or linear form owing to the existence of tension in the supercoiled DNA molecule, not direct result of enzymatic action on the phosphodiester bond.展开更多
The current study aimed to investigate associations of circRNAs and related genetic variants with the risk of prostate cancer(PCa)as well as to elucidate biological mechanisms underlying the associations.We first comp...The current study aimed to investigate associations of circRNAs and related genetic variants with the risk of prostate cancer(PCa)as well as to elucidate biological mechanisms underlying the associations.We first compared expression levels of circRNAs between 25 paired PCa and adjacent normal tissues to identify riskassociated circRNAs by using the MiOncoCirc database.We then used logistic regression models to evaluate associations between genetic variants in candidate circRNAs and PCa risk among 4662 prostate cancer patients and 3114 healthy controls,and identified circHIBADH rs11973492 T>C as a significant risk-associated variant(odds ratio=1.20,95%confidence interval:1.08-1.34,P=7.06×10^(-4))in a dominant genetic model,which altered the secondary structure of the corresponding RNA chain.In the in silico analysis,we found that circHIBADH sponged and silenced 21 RNA-binding proteins(RBPs)enriched in the RNA splicing pathway,among which HNRNPA1 was identified and validated as a hub RBP using an external RNA-sequencing data as well as the in-house(four tissue samples)and publicly available single-cell transcriptomes.Additionally,we demonstrated that HNRNPA1 influenced hallmarks including MYC target,DNA repair,and E2F target signaling pathways,thereby promoting carcinogenesis.In conclusion,genetic variants in circHIBADH may act as sponges and inhibitors of RNA splicing-associated RBPs including HNRNPA1,playing an oncogenic role in PCa.展开更多
文摘The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.
文摘In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.
文摘Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.
文摘Plant RNA N-glycosidase specifically hydrolyzes the N-C glycosidic bond of a conserved adenosine in the sarcin/ricin domain of the largest RNA in ribosome, releasing an adenine base and thus inhibiting protein synthesis. This substrate specificity was challenged later by discovery that various RNA derivatives and DNAs, especially the double-stranded supercoiled DNA could be used as substrate by RNA N-glycosidase. Thus, it was argued whether the DNA-cleaving activity was an intrinsic feature of RNA N-glycosidase or it was contaminated by DNase. In this article, several lines of evidence are presented to show that RNA N-glycosidase can really release the adenine base from the double-stranded supercoi/ed DNA. It was proposed that the cleavage mechanism of supercoiled DNA was the phosphodiester bonds in enzymatically deadenylated regions of the supercoiled DNA would become fragile and liable to produce nicked or linear form owing to the existence of tension in the supercoiled DNA molecule, not direct result of enzymatic action on the phosphodiester bond.
基金supported by the Medical Research Project of Jiangsu Commission of Health(Grant No.M2022015).
文摘The current study aimed to investigate associations of circRNAs and related genetic variants with the risk of prostate cancer(PCa)as well as to elucidate biological mechanisms underlying the associations.We first compared expression levels of circRNAs between 25 paired PCa and adjacent normal tissues to identify riskassociated circRNAs by using the MiOncoCirc database.We then used logistic regression models to evaluate associations between genetic variants in candidate circRNAs and PCa risk among 4662 prostate cancer patients and 3114 healthy controls,and identified circHIBADH rs11973492 T>C as a significant risk-associated variant(odds ratio=1.20,95%confidence interval:1.08-1.34,P=7.06×10^(-4))in a dominant genetic model,which altered the secondary structure of the corresponding RNA chain.In the in silico analysis,we found that circHIBADH sponged and silenced 21 RNA-binding proteins(RBPs)enriched in the RNA splicing pathway,among which HNRNPA1 was identified and validated as a hub RBP using an external RNA-sequencing data as well as the in-house(four tissue samples)and publicly available single-cell transcriptomes.Additionally,we demonstrated that HNRNPA1 influenced hallmarks including MYC target,DNA repair,and E2F target signaling pathways,thereby promoting carcinogenesis.In conclusion,genetic variants in circHIBADH may act as sponges and inhibitors of RNA splicing-associated RBPs including HNRNPA1,playing an oncogenic role in PCa.
