A new method for screening gene mutations by using a Coupled In Vitro Transcription and Translation System is reported in this paper. It includes the following steps: (1) The target DNA fragments with T7T1 sequence a...A new method for screening gene mutations by using a Coupled In Vitro Transcription and Translation System is reported in this paper. It includes the following steps: (1) The target DNA fragments with T7T1 sequence at its 5 prime end are amplified (T7T1: GGATCCTAATACGACTCTATAGGGAG ACCACCATG); (2) The RNA and peptide are synthesized and labeled from the PCR product in the coupled In Vitro Transcription-Translation System; (3) The produced peptides are analyzed by using SDS-PAGE and pH Gradient gel focusing electrophoresis. Four peptide products from 4 HB patients with nonsense mutation in Exon H of F IX gene show truncated protein bands with speeded migration in the autoradiography of the SDS-PAGE. Ten out of 11 HB patients with different missense mutations show abnormal patterns in the autoradiography of a pH 4-7 gradient gel focusing electrophoresis. Conclusion: The PCR and the Coupled In Vitro Transcription-Translation System/SDS-PAGE is a good method for proteins truncation test. The PCR and the Transcription-Translation System combined with pH gradient gel focusing electrophoresis is an efficient method for screening the abnormal protein products from DNA fragments with missense mutations.展开更多
In order to investigate the expression of glycerol-3 -phosphate dehydrogenase by GCY1 gene in recombinant Saccharomyces cerevisiae, induction culture of the S. cerevisiaestrain was performed with SD-URA 2% galactose, ...In order to investigate the expression of glycerol-3 -phosphate dehydrogenase by GCY1 gene in recombinant Saccharomyces cerevisiae, induction culture of the S. cerevisiaestrain was performed with SD-URA 2% galactose, 3 × YP ＋ 6% glucose, SC-URA 2% galactose, and SC-URA 2% galactose ＋ 5% NaCI glyeerol-3-phosphate dehydregenase, the cultured S. cerevisiaewas comminuted followed by full-automatic high-speed purification, and SDS-PAGE gel electrophoresis was performed for molecular weight of the GST fusion protein. The results showed that after shaking culture of the S. cerevisiae containing GCY1 at 25 ℃, the OD values of its 3 × YP ＋ 6% glucose culture and SC-URA 2% galaetose ＋ 5% NaC1 culture were 8.75 and 7.35, respectively. It was shown by purification with a Profinia low-pressure liquid chromatograph that only the S. cerevisiae cultured in SC-URA 2% galactose ＋ 5% NaC1 medium expressed glycerel-3-phosphate de- hydrogenase, the molecular weight of which was detected as 65 ku by SDS-PAGE gel electrophoresis.展开更多
In the present study,myofibrillar proteins were extracted from the meat proteins of beef,lamb,chicken,tuna and emperor fish using non-denaturation method,and their physico-chemical and rheological properties were asse...In the present study,myofibrillar proteins were extracted from the meat proteins of beef,lamb,chicken,tuna and emperor fish using non-denaturation method,and their physico-chemical and rheological properties were assessed.The myofibrillar proteins of beef,emperor and lamb samples had higher percentage of protein extractability than tuna and chicken samples.The tuna sample showed significantly higher bound bromophenol blue(BPB)value while lamb samples showed lower value(P<0.05).The myofibrillar protein of chicken sample was found to have more ionic and hydrogen bonds than all other myofibrillar samples.The disulphide bonds in tuna and lamb myofibrillar protein samples were significantly higher than other three samples(P<0.05).The myofibrillar protein samples showed major bands myosin heavy chain,α-actinin,desimin,actin,troponin,tropomyosin and myosin light chain with wider molecular weight distribution in the range of 20-200 ku.The myofibrillar proteins exhibited Newtonian and shear thickening nature behaviour at lower protein concentration(1 mg/mL)as revealed by flow profile and visco-elastic analysis using rheometer.展开更多
文摘A new method for screening gene mutations by using a Coupled In Vitro Transcription and Translation System is reported in this paper. It includes the following steps: (1) The target DNA fragments with T7T1 sequence at its 5 prime end are amplified (T7T1: GGATCCTAATACGACTCTATAGGGAG ACCACCATG); (2) The RNA and peptide are synthesized and labeled from the PCR product in the coupled In Vitro Transcription-Translation System; (3) The produced peptides are analyzed by using SDS-PAGE and pH Gradient gel focusing electrophoresis. Four peptide products from 4 HB patients with nonsense mutation in Exon H of F IX gene show truncated protein bands with speeded migration in the autoradiography of the SDS-PAGE. Ten out of 11 HB patients with different missense mutations show abnormal patterns in the autoradiography of a pH 4-7 gradient gel focusing electrophoresis. Conclusion: The PCR and the Coupled In Vitro Transcription-Translation System/SDS-PAGE is a good method for proteins truncation test. The PCR and the Transcription-Translation System combined with pH gradient gel focusing electrophoresis is an efficient method for screening the abnormal protein products from DNA fragments with missense mutations.
基金Supported by Social Service Project of New Countryside Development Research Institute of Yangtze University(201411)
文摘In order to investigate the expression of glycerol-3 -phosphate dehydrogenase by GCY1 gene in recombinant Saccharomyces cerevisiae, induction culture of the S. cerevisiaestrain was performed with SD-URA 2% galactose, 3 × YP ＋ 6% glucose, SC-URA 2% galactose, and SC-URA 2% galactose ＋ 5% NaCI glyeerol-3-phosphate dehydregenase, the cultured S. cerevisiaewas comminuted followed by full-automatic high-speed purification, and SDS-PAGE gel electrophoresis was performed for molecular weight of the GST fusion protein. The results showed that after shaking culture of the S. cerevisiae containing GCY1 at 25 ℃, the OD values of its 3 × YP ＋ 6% glucose culture and SC-URA 2% galaetose ＋ 5% NaC1 culture were 8.75 and 7.35, respectively. It was shown by purification with a Profinia low-pressure liquid chromatograph that only the S. cerevisiae cultured in SC-URA 2% galactose ＋ 5% NaC1 medium expressed glycerel-3-phosphate de- hydrogenase, the molecular weight of which was detected as 65 ku by SDS-PAGE gel electrophoresis.
文摘In the present study,myofibrillar proteins were extracted from the meat proteins of beef,lamb,chicken,tuna and emperor fish using non-denaturation method,and their physico-chemical and rheological properties were assessed.The myofibrillar proteins of beef,emperor and lamb samples had higher percentage of protein extractability than tuna and chicken samples.The tuna sample showed significantly higher bound bromophenol blue(BPB)value while lamb samples showed lower value(P<0.05).The myofibrillar protein of chicken sample was found to have more ionic and hydrogen bonds than all other myofibrillar samples.The disulphide bonds in tuna and lamb myofibrillar protein samples were significantly higher than other three samples(P<0.05).The myofibrillar protein samples showed major bands myosin heavy chain,α-actinin,desimin,actin,troponin,tropomyosin and myosin light chain with wider molecular weight distribution in the range of 20-200 ku.The myofibrillar proteins exhibited Newtonian and shear thickening nature behaviour at lower protein concentration(1 mg/mL)as revealed by flow profile and visco-elastic analysis using rheometer.
