A novel detection of single-stranded DNA binding protein based on ss-DNA modified chip using surface plasmon resonance microscopy

An ss-DNA gold chip was prepared based on self-assembly of the thiol-derivatized oligonucleotide, and used for the determination of single-stranded binding protein （SSB） by surface plasmon resonance microscopy （SPR）. The experiment results showed that SSB binds ss-DNA with high specificity, and relative signal of SPR response is proportional to the concentration of SSB in the range of 0.1-100 ng/mL with a detection limit （S/N = 3） of 0.07 ng/mL.

Single-stranded RNA as primers of terminal deoxynucleotidyl transferase for template-independent DNA polymerization

Terminal deoxynucleotidyl transferase(Td T) has been characterized as template-independent polymerase using single-stranded DNA(ss DNA) as primers to generate random oligonucleotides. However, the extension performance of Td T to single-stranded RNA(ss RNA) is vague. By systematically comparing and contrasting the performance of Td T-catalyzed ss DNA and ss RNA extension, it is indicated that the catalytic efficiency of ss RNA as primers was about 3 times lower than ss DNA as primers. Collectively, it is believed that understanding the catalytic performance of Td T will help to design the strategy to synthesize chimeric DNA on 3-OH of ss RNA, which becomes invaluable.

Plant and animal positive-sense single-stranded RNA viruses encode small proteins important for viral infection in their negative-sense strand

Positive-sense single-stranded RNA(+ssRNA)viruses,the most abundant viruses of eukaryotes in nature,require the synthesis of negative-sense RNA(-RNA)using their genomic(positive-sense)RNA(+RNA)as a template for replication.Based on current evidence,viral proteins are translated via viral+RNAs,whereas-RNA is considered to be a viral replication intermediate without coding capacity.Here,we report that plant and animal+ssRNA viruses contain small open reading frames(ORFs)in their-RNA(reverse ORFs[rORFs]).Using turnip mosaic virus(TuMV)as a model for plant+ssRNA viruses,we demonstrate that small proteins encoded by rORFs display specific subcellularlocalizations,and confirm the presence of rORF2 in infected cells through mass spectrometry analysis.The protein encoded by TuMV rORF2 forms punctuate granules that are localized in the perinuclear region and co-localized with viral replication complexes.The rORF2 protein can directly interact with the viral RNA-dependent RNA polymerase,and mutation of rORF2 completely abolishes virus infection,whereas ectopic expression of rORF2 rescues the mutant virus.Furthermore,we show that several rORFs in the-RNA of severe acute respiratory syndrome coronavirus 2(SARS-CoV-2)have the ability to suppress type l interferon production and facilitate the infection of ve-sicular stomatitis virus.In addition,we provide evidence that TuMV might utilize internal ribosome entry sites to translate these small rORFs.Taken together,these findings indicate that the-RNA of+ssRNA vi-ruses can also have the coding capacity and that small proteins encoded therein play critical roles in viral infection,revealing a viral proteome larger than previously thought.

Prolonged control of insulin-dependent diabetes via intramuscular expression of plasmid-encoded single-strand insulin analogue

Daily insulin injection is necessary for the treatment of the insulin-dependent diabetes. However, the process is painful and inconvenient. Accordingly, we have made exploratory efforts to establish an alternative method for continuous insulin supply via intramuscular injection of a designed plasmid encoding the single-strand insulin analogue (SIA), which provides safe, effective and prolonged control of insulin-dependent diabetes. To generate a SIA, a short flexible peptide was alternatively introduced into the natural proinsulin to replace its original long and rigid C-peptide. Then, the synthetic promoter SP301 was used to drive potent and specific expression of SIA in skeletal muscle cells. By combining the Pluronic L64 and low-voltage electropulse (L/E), the specialized gene delivery technique was applied to efficiently transfer the constructed plasmid into skeletal muscle cells via intramuscular injection. Through these efforts, a plasmid-based intramuscular gene expression system was established and improved, making it applicable for gene therapy. The plasmid-expressed SIA showed biological functions that were similar to that of natural insulin. A single L/E-pSP301-SIA administration provided sustained SIA expression in vivo for about 1.5 months. In addition, the diabetic mice treated with L/E-pSP301-SIA were much healthier than those with other treatments. This plasmid-based system was safe for the treatment of diabetes and did not cause immune responses or pathological damage. The results confirmed that, in a mouse model, long-term positive effects were achieved by a single intramuscular L/E-pSP301-SIA injection, which consequently provided reliable experimental basis for its clinical application for the treatment of diabetes mellitus with promising prospects.

Determination of DNA single-strand breaks by low-energy heavy ion and analysis of dose-effect curves

Calf thymus DNA was exposed to low-energy heavy ions (N+) and 60Co-γ-rays, and the dose-effect on DNA single-strand breaks (SSB) has been investigated. The results indicate that the dose-effect curve by N+ irradiation is different from that of conventional ionizing radiation. While the curve from γ-irradiation follows exponential type, the effect curve produced by N+ ion is of 'saddle type'. The yield of DNASSB per dose unit per DNA unit remained at a certain level under different doses of γ-rays. In contrast, the DNASSB at low dosage region of N+ showed an obvious peak before it decreased rapidly to a lower level.

Microbial community structure in different wastewater treatment processes characterized by single-strand conformation polymorphism (SSCP) technique

In order to investigate microbial community structures in different wastewater treatment processes and understand the relationship between the structures and the status of processes,the microbial community diversity,variety and distribution in five wastewater treatment pro cesses were studied by a culture-independent genetic fingerprinting technique single-strand conformation poly-morphism(SSCP).The five processes included denitrifying and phosphate-removal system(diminished N),Chinese traditional medicine wastewater treatment system(P),beer wastewater treatment system(W),fermentative biohydrogen-producing system(H),and sulfate-reduction system(S).The results indicated that the microbial community profiles in the wastewater bioreactors with the uniform status were very similar.The diversity of microbial populations was correlated with the complexity of organic contaminants in wastewater.Chinese traditional medicine wastewater contained more complex organic components;hence,the population diversity was higher than that of simple nutrient bioreactors fed with molasses wastewater.Compared with the strain bands in a simulated community,the relative proportion of some functional microbial populations in bioreactors was not dom-inant.Fermentative biohydrogen producer Ethanoligenens harbinense in the better condition bioreactor had only a 5% band density,and the Desulfovibrio sp.in the sulfate-reducing bioreactor had less than 1.5%band density.The SSCP profiles could identify the difference in microbial community structures in wastewater treatment processes,monitor some of the functional microbes in these processes,and consequently provide useful guidance for improving their efficiency.

Single-strand conformation polymorphism for analysis of genomic variability of hepatitis C virus non

Objective To establish a convenient method to detect the genomic population with hepatitis C virus (HCV) at nonstructure 5A (NS5A) region and to determine the correlation between the genomic population complexity at NS5A region and disease stage. Methods The sera from 52 patients with chronic hepatitis C virus infections were analysed using single strand conformation polymorphism (SSCP). In the SSCP, an asymmetric polymerase chain reaction (PCR) was carried out on the 455 bp products of the first round PCR at the NS5A region and the number of band of single strand deoxyribonucleic acid (DNA) which reacted with complemental DNA probe specific for the NS5A region after gel electrophoresis was analyzed. Results In 90% patients with chronic persistent hepatitis, the bands of single strand DNA was limited to one, and in those with chronic active hepatitis or liver cirrhosis, two or more bands of DNA were frequently detected. In about half of patients with hepatocellularcarcinoma, three or more bands were found. The number of bands increased with the progression of liver disease. The multivariate analysis showed that the progression of liver disease was the independent factor of viral diversity (P<0.025) and was not related to the age, sex, the route of infection and the titer of hepatitis C virus ribonucleic acid (HCV RNA). Conclusion These results suggest that the genomic variability of HCV at NS5A region increases with the progression of liver disease, and this may be closely related to the clinical features of type C liver disease.

Orthogonal assays for the identification of inhibitors of the single-stranded nucleic acid binding protein YB-1

We have previously shown that high expression of the nucleic acid binding factor YB-1 is strongly associated with poor prognosis in a variety of cancer types. The 3-dimensional protein structure of YB-1 has yet to be determined and its role in transcriptional regulation remains elusive. Drug targeting of transcription factors is often thought to be difficult and there are very few published high-throughput screening approaches. YB-1 predominantly binds to single-stranded nucleic acids, adding further difficulty to drug discovery. Therefore, we have developed two novel screening assays to detect compounds that interfere with the transcriptional activation properties of YB-1, both of which may be generalizable to screen for inhibitors of other nucleic acid binding molecules. The first approach is a cell-based luciferase reporter gene assay that measures the level of activation of a fragment of the E2 F1 promoter by YB-1. The second approach is a novel application of the Alpha Screen system, to detect interference of YB-1 interaction with a single-stranded DNA binding site. These complementary assays examine YB-1 binding to two discrete nucleic acid sequences using two different luminescent signal outputs and were employed sequentially to screen 7360 small molecule compounds leading to the identification of three putative YB-1 inhibitors.

Ataxia-telangiectasia mutated plays an important role in cerebellar integrity and functionality

Accumulating evidence indicates that ataxia-telangiectasia mutated kinase is critical for maintaining cellular homeostasis and that it has both nuclear and cytoplasmic functions.However,the functions of ataxia-telangiectasia mutated that when lost lead to cerebellar degeneration are still unknown.In this review,we first describe the role of ataxia-telangiectasia mutated in cerebellar pathology.In addition to its canonical nuclear functions in DNA damage response circuits,ataxia-telangiectasia mutated functions in various cytoplasmic and mitochondrial processes that are critically important for cellular homeostasis.We discuss these functions with a focus on the role of ataxia-telangiectasia mutated in maintaining the homeostatic redox state.Finally,we describe the unique functions of ataxia-telangiectasia mutated in various types of neuronal and glial cells including cerebellar granule neurons,astrocytes,and microglial cells.

A circular single-stranded DNA mycovirus infects plants and confers broad-spectrum fungal resistance

Circular single-stranded DNA(ssDNA)viruses have been rarely found in fungi,and the evolutionary and ecological relationships among ssDNA viruses infecting fungi and other organisms remain unclear.In this study,a novel circular ssDNA virus,tentatively named Diaporthe sojae circular DNA virus 1(DsCDV1),was identified in the phytopathogenic fungus Diaporthe sojae isolated from pear trees.DsCDV1 has a monopartite genome(3185 nt in size)encapsidated in isometric virions(21-26 nm in diameter).The genome comprises seven putative open reading frames encoding a discrete replicase(Rep)split by an intergenic region,a putative capsid protein(CP),several proteins of unknown function(P1-P4),and a long intergenic region.Notably,the two split parts of DsCDV1 Rep share high identities with the Reps of Geminiviridae and Genomoviridae,respectively,indicating an evolutionary linkage with both families.Phylogenetic analysis based on Rep or CP sequences placed DsCDV1 in a unique cluster,supporting the establishment of a new family,tentatively named Gegemycoviridae,intermediate to both families.DsCDV1 significantly attenuates fungal growth and nearly erases fungal virulence when transfected into the host fungus.Remarkably,DsCDV1 can systematically infect tobacco and pear seedlings,providing broad-spectrum resistance to fungal diseases.Subcellular localization analysis revealed that DsCDV1 P3 is systematically localized in the plasmodesmata,while its expression in trans-complementation experiments could restore systematic infection of a movement-deficient plant virus,suggesting that P3 is a movement protein.DsCDV1 exhibits unique molecular and biological traits not observed in other ssDNA viruses,serving as a link between fungal and plant ssDNA viruses and presenting an evolutionary connection between ssDNA viruses and fungi.These findings contribute to expanding our understanding of ssDNA virus diversity and evolution,offering potential biocontrol applications for managing crucial plant diseases.

The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.

Asymmetric PCR method in generation of HBV ssDNA for pyrosequencing

Objective To explore the optimal primer ratio and concentration of asymmetric polymerase chain reaction (A-PCR) in producing hepatitis B virus (HBV) single-stranded DNA (ssDNA) for pyrosequencing. Methods A-PCR was carried out to generate HBV ssDNA with forward to reverse primers of different ratios (50∶1, 100∶1) and concentrations (13.0 pmol/25μL and 0.14 pmol/25μL, 19.5 pmol/25μL and 0.21 pmol/25μL), and the product yield and quality were compared respectively. Results The forward to reverse primer ratio of 50∶1 provided better yield and concentration of 19.5 pmol/25μL and 0.21 pmol//25μL generated a clearer band. Conclusion A simple and feasible method to produce HBV ssDNA for pyrosequencing in batch is established.

Evolution based on genome structure: the “diagonal genome universe”

The ratios of amino acid to the total amino acids and those of nucleotides to the total nucleotides in genes or genomes are suitable indexes to compare whole gene or genome characteristics based on the large number of nucleotides rather than their sequences. As these ratios are strictly calculated from nucleotide sequences, the values are independent of experimental errors. In the present mini-review, the following themes are approached according to the ratios of amino acids and nucleotides to their total numbers in the genome: prebiotic evolution, the chronological precedence of protein and codon formations, genome evolution, Chargaff’s second pa- rity rule, and the origins of life. Amino acid formation might have initially occurred during pre- biotic evolution, the “amino acid world”, and amino acid polymerization might chronologically precede codon formation at the end of prebiotic evolution. All nucleotide alterations occurred synchronously over the genome during biolo- gical evolution. After establishing primitive lives, all nucleotide alterations have been governed by linear formulae in nuclear and organelle genomes consisting of the double-stranded DNA. When the four nucleotide contents against each individual nucleotide content in organelles are expressed by four linear regression lines representing the diagonal lines of a 0.5 square – the “Diagonal Genome Universe”, evolution obeys Chargaff’s second parity rule. The fact that linear regression lines intersect at a single point su- ggests that all species originated from a single life source.

Application of PCR-SSCP in detecting rpoB drug resistant gene polymorphism of M. tuberculosis L-form from pneumoconiosis patients with tuberculosis

Objective: To study the relationship between the polymorphism of drug resistant gene rpoB and drug resistance against rifampicin(RFP) of M. tuberculosis L-forms, and to evaluate its clinical application. Methods: A total of 52 clinical isolated strains of M. tuberculosis L-forms were collected. rpoB gene polymorphism was analyzed by polymerase chain reaction and single-strand conformation polymorphism (PCR-SSCP) and conventional antimicrobial susceptibility test (AST). Their results were compared. Results: AST results showed that 38 of 52 clinical isolated strains were drug resistance (73.08％),while PCR-SSCP indicated 65.38％ (32/52) rpoB gene polymorphism. There was no statistic significance(χ2= 2.4914) between the 2 methods. Conclusion:Combined the application of PCR-SSCP with AST in detecting rpoB drug resistant gene polymorphism of M. tuberculosis L-form from pneumoconiosis patients with tuberculosis may have advantages at earlier diagnosis and guidance of clinical medications.

Oxidation degree dependent adsorption of ssDNA onto graphene-based surface

DNA/GO composite plays a significant role in the research field of biotechnology and nanotechnology,and attracts a great deal of interest.However,it is still unclear how the oxidation degree of the graphene-based surface affects the adsorption process of single-strand DNA(ssDNA).In this paper,based on the molecular dynamics simulations,we find that ssDNA molecule is absorbed on the GO surface in the most stable state with the oxidation degree around 15%.The microscopic mechanism is attributed to the van Der Walls and the electrostatic interactions between the ssDNA molecule and the graphene-based surface,which is accompanied with theπ-πstacking and hydrogen bond formation.The number ofπ-πstacking between ssDNA and GO reaches the maximum value when the oxidation degree is around 15%among all the GO surfaces.Our simulation results also reveal the coexistence of stretched and curved configurations as well as the adsorption orientation of ssDNA on the GO surface.Furthermore,it is found that the absorbed ssDNA molecules are more likely to move on the graphene-based surface of low oxidation degree,especially on pristine graphene.Our work provides the physics picture of ssDNA’s physisorption dynamics onto graphene-based surface and it is helpful in designing DNA/GO nanomaterials.

DETECTION OF STRAND BREAKS OF DNA IN HUMAN EARLY CHORIONIC VILLUS CELLS INDUCED BY DIAGNOSTIC ULTRASOUND USING ^(32)P-LABELED ALU HYBRIDIZATION

Objective To explore if strand breaks of DNA in human early chorionic villus cells in uterus were induced by diagnostic ultrasound and to evaluate the method used for detection of single-stranded breaks and double-stranded breaks in human DNA. Methods 60 normal pregnant women aged 20-30, who underwent artificial abortion during 6-8 weeks of gestation, were randomly divided into 2 experimental groups: All 30 cases were exposed to diagnostic ultrasound in uterus for 10 minutes, and 24 hours later chorionic villi were extracted; the other 30 cases were taken as the control group. Single-stranded DNA and double-stranded DNA in villus cells in all cases were isolated by the alkaline unwinding combined with hydroxylapatite chromatography, and were quantitatively detected using 32 P-labeled Alu probe for dot-blotting hybridization. Results There was no significant difference in quantity and percentage in single-stranded DNA and double-stranded DNA between 2 groups (P>0.05). 32 P-Alu probe could only hybridize with human DNA, and could detect DNA isolated from as few as 2.5×10 3 chorionic villus cells and 0.45ng DNA in human leukocytes. Conclusion The results suggested that there were no DNA strand damages in human chorionic villus cells when the uterus was exposed to diagnostic ultrasound for 10 minutes. The method,^(32)P-Alu probe for dot-blotting hybridization, was even more specific, sensitive and accurate than conventional approaches.

Cloning and Sequence Analysis of lef-3 Gene from Pieris rapae Granulovirus

To better understand the origination and evolution of lef-3 gene from baculovirus genome and determine the relationships between various viruses at molecular level, late expression factor 3 gene （lef-3） fragments of Pieris rapae granulovirus were obtained through conventional PCR method and sequenced after cloned into T-vector. Then, bioinformatics analysis on lef-3 gene and its encoding sequences were conducted by using bid-softs. Four mutations were appeared in the ORF of cloned lef-3 gene, which did not alter the characteristics of amino acids. It was inferred that PiraGV LEF-3 protein contained 399 amino acids, the molecular weight of which was 3.99 kD. Prediction of the LEF-3 advanced structure and homology comparison between other LEF-3 from various baculoviruses showed that the lef-3 gene might encode the single-stranded DNA-binding protein. The result of BLAST revealed that the lef-3 gene only existed in Lepidoptera host for the baculovirus genome, and the evolution analysis illustrated that lef-3 gene could be divided into 3 groups including one granulovirus （GV） group and 2 nucleopolyhedrovirus （NPV） groups. The selection pressure analysis of GV lef-3 gene coding region showed that the majority of lef-3 genes performed negative selection, while the Ka/Ks differed from different lef-3 gene, to some extent, which also performed positive selection. The origination analysis revealed that lef-3 gene of baculovirus might derive from bacteria. The lef-3 gene of PiraGV was cloned successfully and the possible patterns of origination and evolution were speculated through bioinformatics analysis.

Detection of the polymorphism at codon 72 in exon 4 of p53 gene by PCR－SSCP

By employing different gel components and electrophoresis conditions, the PCR-SSCP(polymerase chain reaction-single-stranded conformation polymorphism) method was used to detect the polymorphism(CCC or CGC ) of codon 72 in exon 4 of p53 gene. The results

Detecting drug resistant genetic mutation among pneumoconiosis patients complicated with tuberculosis in Mycobacterium tuberculosis L-forms application of PCR-SSCP technique in Huainan mining district

Objective： To study the relationship between drug resistant genetic mutation and drug resistance in Mycobacterium tuberculosis L-form, discuss the internal relationship between drug resistances and drug-resistant related genes and explore the value of PCR- SSCP to clinical application. Methods： A total of 52 clinically isolated strains of tuberculosis L-form were collected among 97 pneumoconiosis patients complicated with tuberculosis. The gene mutations of katG, rpoB and rpsL were detected by PCR-SSCP, and the results were compared with those analyzed by traditional antimicrobial susceptibility test（AST）. Results： The gene muta- tion rates of katG, rpoB and rpsL by PCR-SSCP were respectively 57.70% （30/52）, 65.38% （32/52） and 40.38% （21/52）. The rate of reversion was 78.85%（41/52） and the result of drag-resistant genes was invariable. The results of AST showed that there were 40 （76.92%） multi-drug resistant strains in 52 clinically isolated strains. The number for three-drug resistant strain was 21 （40.38%） and that of two-drug resistant was 19（36.54%）, but only 12（23.08%） strains were one drug resistant. The rate of total drug-resistance was 100%, but there were 15 strains of allied mutation of three genes, 16 of two mutations and 6 of only one by PCR-SSCP. The coincidences were respectively 71.43%, 84.12% and 50.00%. Then there was no significant difference between the allied mutations of multi-drug resistant gene and the mutations of only one drug resistant gene （P 〉 0.05）. Conclusion： PCR-SSCP technique has a higher sensibility and specificity to detect the genes of katG, rpoB and rpsL in tuberculosis L-form among pneumoconiosis complicated with tuberculosis,and the detecting rate of two drug resistant strains and three drug resistant strains was higher. The combined application of PCR-SSCP and AST has advantages at earlier diagnosis and guidance of clinical medications.

Aptamer-Based Extraction of Ergot Alkaloids from Ergot Contaminated Rye Feed

Ergot alkaloids are mycotoxins which can be found in food based on cereal-crops, due to a contamination of plants by fungi of the genus Claviceps. The ingestion of ergot contaminated cereal crops can lead to a severe poisoning known as ergotism. For food and feed safety purposes, the extraction of ergot alkaloids from ergot contaminated flour was investigated. For the specific recognition of ergot alkaloids, DNA aptamer ligands specially selected for ergot alkaloids were grafted onto silica gel in order to construct a specific solid phase extraction system. The aptamer-functionalized silica gels were used to extract ergot alkaloids from a contaminated rye feed sample. The presence of ergot alkaloids eluted from the aptamer-functionalized silica gels was analyzed using LC-QTOF-MS. By using this simple system, it was possible to specifically extract ergosine, ergokryptine and ergocornine from an ergot contaminated rye feed sample. This aptamer-based extraction tool shows the applicability of aptamers for the specific extraction of toxins or natural compounds from turbid matrices in a one-step procedure.