Commercial oil flow has been obtained from the sandstone reservoir of the Lower Silurian Kelpintag Formation in the Well Shun-9 prospect area.In the present studies,10 Silurian oil and oil sand samples from six wells ...Commercial oil flow has been obtained from the sandstone reservoir of the Lower Silurian Kelpintag Formation in the Well Shun-9 prospect area.In the present studies,10 Silurian oil and oil sand samples from six wells in the area were analyzed for their molecular and carbon isotopic compositions,oil alteration（biodegradation）,oil source rock correlation and oil reservoir filling direction.All the Silurian oils and oil sands are characterized by low Pr/Ph and C21/C23 tricyclic terpane（〈1.0） ratios,＂V＂-pattern C27-C29 steranes distribution,low C28-sterane and triaromatic dinosterane abundances and light δ13C values,which can be correlated well with the carbonate source rock of the O3 l Lianglitage Formation.Different oil biodegradation levels have also been confirmed for the different oils/oil sands intervals.With the S1k2 seal,oils and oil sands from the S1k1 interval of the Kelpintag Formation have only suffered light biodegradation as confirmed by the presence of ＂UCM＂ and absence of 25-norhopanes,whereas the S1k3-1 oil sands were heavily biodegraded（proved by the presence of 25-norhopanes） due to the lack of the S1k2 seal,which suggests a significant role of the S1k2 seal in the protection of the Silurian oil reservoir.Based on the Ts/（Ts＋Tm） and 4-/1-MDBT ratios as reservoir filling tracers,a general oil filling direction from NW to SE has been also estimated for the Silurian oil reservoir in the Well Shun-9 prospect area.展开更多
The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the o...The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.展开更多
3-Arylisothiazolo[5,4-b]quinolin-4(9H)-ones and 3-arylisoxazolo[5,4-b]quinolin-4(9H)-ones were synthesized and assayed for affinity for the benzodiazepine binding site of the GABAA receptors. While the 3-arylisothiazo...3-Arylisothiazolo[5,4-b]quinolin-4(9H)-ones and 3-arylisoxazolo[5,4-b]quinolin-4(9H)-ones were synthesized and assayed for affinity for the benzodiazepine binding site of the GABAA receptors. While the 3-arylisothiazoloquinolin-4-ones were found to be potent ligands, with affinities (expressed as the affinity Ki value) down to 1 nM, the 3-arylisoxazoloquinolin-4-ones are less potent. This is suggested to depend on sterical repulsive interaction of the 3-arylisoxazoloquinolin-4-ones with the receptor essential volume of the binding site, and a higher electron density at the nitrogen in the azole ring (N-2) as well as the carbonyl oxygen in the isothiazoloquinolin-4-ones enabling them to interact stronger with hydrogen bond donor sites at the binding site.展开更多
Bone Morphogenetic proteins(BMPs)like BMP2 and BMP7 have shown great potential in the treatment of severe bone defects.In recent in vitro studies,BMP9 revealed the highest osteogenic potential compared to other BMPs,p...Bone Morphogenetic proteins(BMPs)like BMP2 and BMP7 have shown great potential in the treatment of severe bone defects.In recent in vitro studies,BMP9 revealed the highest osteogenic potential compared to other BMPs,possibly due to its unique signaling pathways that differs from other osteogenic BMPs.However,in vivo the bone forming capacity of BMP9-adsorbed scaffolds is not superior to BMP2 or BMP7.In silico analysis of the BMP9 protein sequence revealed that BMP9,in contrast to other osteogenic BMPs such as BMP2,completely lacks so-called heparin binding motifs that enable extracellular matrix(ECM)interactions which in general might be essential for the BMPs’osteogenic function.Therefore,we genetically engineered a new BMP9 variant by adding BMP2-derived heparin binding motifs to the N-terminal segment of BMP9′s mature part.The resulting protein(BMP9 HB)showed higher heparin binding affinity than BMP2,similar osteogenic activity in vitro and comparable binding affinities to BMPR-II and ALK1 compared to BMP9.However,remarkable differences were observed when BMP9 HB was adsorbed to collagen scaffolds and implanted subcutaneously in the dorsum of rats,showing a consistent and significant increase in bone volume and density compared to BMP2 and BMP9.Even at 10-fold lower BMP9 HB doses bone tissue formation was observed.This innovative approach of significantly enhancing the osteogenic properties of BMP9 simply by addition of ECM binding motifs,could constitute a valuable replacement to the commonly used BMPs.The possibility to use lower protein doses demonstrates BMP9 HB’s high translational potential.展开更多
Piezocatalytic activation of persulfate(PS) has great application potential in environmental remediation;however,the relationship between piezocatalyst thickness and catalytic activity is not clear,limiting the furthe...Piezocatalytic activation of persulfate(PS) has great application potential in environmental remediation;however,the relationship between piezocatalyst thickness and catalytic activity is not clear,limiting the further improvement of catalytic activity and application of the technology.Herein,the Bi_(2)Fe_(4)O_(9)(BFO) piezocatalysts with tunable thickness were prepared through a facile hydrothermal method by tuning the molar ratio of Bi(NO_(3)),5H_(2)O and FeCl_(3)·6H_(2)O for piezocatalytic activation of peroxydisulfate(PDS).The BFO with the smallest thickness exhibits excellent catalytic activity,and the SO_(4)^(·-)and ·OH are the major reactive oxygen species for degrading organic pollutants.Further XPS investigations and finite element analyses demonstrate that the decreased thickness of BFO not only exposes more Fe^(2+)sites for PDS activation,but also improve the piezoelectric effect to accelerate the regeneration of Fe^(2+),thus enabling an enhanced synergy effect between PDS activation and piezocatalysis for outstanding catalytic activity.This work provides an understanding of the relationship between thickness of piezocatalysts and its catalytic activity over PDS activation,facilitating the development of more efficient piezocatalysts and PS-based advanced oxidation processes.展开更多
Since mid-2016,the low pathogenic H7N9 influenza virus has evolved into a highly pathogenic(HP)phenotype in China,raising many concerns about public health and poultry industry.The insertion of a“KRTA”motif at hemag...Since mid-2016,the low pathogenic H7N9 influenza virus has evolved into a highly pathogenic(HP)phenotype in China,raising many concerns about public health and poultry industry.The insertion of a“KRTA”motif at hemagglutinin cleavage site(HACS)occurred in the early stage of HP H7N9 variants.During the co-circulation,the HACS of HP-H7N9 variants were more polymorphic in birds and humans.Although HP-H7N9 variants,unlike the H5 subtype virus,exhibited the insertions of basic and non-basic amino acids,the underlying function of those insertions and substitutions remains unclear.The results of bioinformatics analysis indicated that the PEVPKRKRTAR/G motif of HACS had become the dominant motif in China.Then,we generated six H7N9 viruses bearing the PEIPKGR/G,PEVPKGR/G,PEVPKRKRTAR/G,PEVPKGKRTAR/G,PEVPKGKRIAR/G,and PEVPKRKRR/G motifs.Interestingly,after the deletion of threonine and alanine(TA)at HACS,the H7N9 viruses manifested decreased thermostability and virulence in mice,and the PEVPKRKRTAR/G-motif virus is prevalent in birds and humans probably due to its increased transmissibility and moderate virulence.By contrast,the insertion of non-basic amino acid isoleucine and alanine(IA)decreased the transmissibility in chickens and virulence in mice.Remarkably,the I335V substitution of H7N9 virus enhanced infectivity and transmission in chickens,suggesting that the combination of mutations and insertions of amino acids at the HACS promoted replication and pathogenicity in chickens and mice.The ongoing evolution of H7N9 increasingly threatens public health and poultry industry,so,its comprehensive surveillance and prevention of H7N9 viruses should be pursued.展开更多
CRISPR/Cas9-mediated homology-directed recombination is an efficient method to express target genes.Based on the above method,providing ideal neutral integration sites can ensure the reliable,stable,and high expressio...CRISPR/Cas9-mediated homology-directed recombination is an efficient method to express target genes.Based on the above method,providing ideal neutral integration sites can ensure the reliable,stable,and high expression of target genes.In this study,we obtained a fluorescent transformant with neutral integration and high expression of the GFP expression cassette from the constructed GFP expression library and named strain FS.The integration site mapped at 4886 bp upstream of the gene FVRRES_00686 was identified in strain FS based on a Y-shaped adaptor-dependent extension,and the sequence containing 600 bp upstream and downstream of this site was selected as the candidate region for designing sgRNAs(Sites)for CRISPR/Cas9-mediated homology-directed recombination.PCR analysis showed that the integration efficiency of CRISPR/Cas9-mediated integration of target genes in designed sites reached 100%.Further expression stability and applicability analysis revealed that the integration of the target gene into the above designed sites can be stably inherited and expressed and has no negative effect on the growth of F.venenatum TB01.These results indicate the above designed neutral sites have the potential to accelerate the development of F.venenatum TB01 through overexpression of target genes in metabolic engineering.展开更多
基金the Northwest Branch Company, SINOPEC for access to samples and grant support
文摘Commercial oil flow has been obtained from the sandstone reservoir of the Lower Silurian Kelpintag Formation in the Well Shun-9 prospect area.In the present studies,10 Silurian oil and oil sand samples from six wells in the area were analyzed for their molecular and carbon isotopic compositions,oil alteration（biodegradation）,oil source rock correlation and oil reservoir filling direction.All the Silurian oils and oil sands are characterized by low Pr/Ph and C21/C23 tricyclic terpane（〈1.0） ratios,＂V＂-pattern C27-C29 steranes distribution,low C28-sterane and triaromatic dinosterane abundances and light δ13C values,which can be correlated well with the carbonate source rock of the O3 l Lianglitage Formation.Different oil biodegradation levels have also been confirmed for the different oils/oil sands intervals.With the S1k2 seal,oils and oil sands from the S1k1 interval of the Kelpintag Formation have only suffered light biodegradation as confirmed by the presence of ＂UCM＂ and absence of 25-norhopanes,whereas the S1k3-1 oil sands were heavily biodegraded（proved by the presence of 25-norhopanes） due to the lack of the S1k2 seal,which suggests a significant role of the S1k2 seal in the protection of the Silurian oil reservoir.Based on the Ts/（Ts＋Tm） and 4-/1-MDBT ratios as reservoir filling tracers,a general oil filling direction from NW to SE has been also estimated for the Silurian oil reservoir in the Well Shun-9 prospect area.
基金supported by the National Transgenic Project of China (2016ZX08010001-002 and 2016ZX08010005-001)the National Natural Science Foundation of China (81471001)the Inner Mongolia Science and Technology Program, China (201502073)
文摘The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.
基金Financial support from the Swedish Board for Scientific Research(VR),the Knut and Alice Wallenberg Foundation,the Research School for Pharmaceutical Sciences at Lund University,Carlsberg Foundation,Denmark,and the NeuroScience PharmaBiotec Research Center,Den-mark,is gratefully acknowledged.
文摘3-Arylisothiazolo[5,4-b]quinolin-4(9H)-ones and 3-arylisoxazolo[5,4-b]quinolin-4(9H)-ones were synthesized and assayed for affinity for the benzodiazepine binding site of the GABAA receptors. While the 3-arylisothiazoloquinolin-4-ones were found to be potent ligands, with affinities (expressed as the affinity Ki value) down to 1 nM, the 3-arylisoxazoloquinolin-4-ones are less potent. This is suggested to depend on sterical repulsive interaction of the 3-arylisoxazoloquinolin-4-ones with the receptor essential volume of the binding site, and a higher electron density at the nitrogen in the azole ring (N-2) as well as the carbonyl oxygen in the isothiazoloquinolin-4-ones enabling them to interact stronger with hydrogen bond donor sites at the binding site.
文摘Bone Morphogenetic proteins(BMPs)like BMP2 and BMP7 have shown great potential in the treatment of severe bone defects.In recent in vitro studies,BMP9 revealed the highest osteogenic potential compared to other BMPs,possibly due to its unique signaling pathways that differs from other osteogenic BMPs.However,in vivo the bone forming capacity of BMP9-adsorbed scaffolds is not superior to BMP2 or BMP7.In silico analysis of the BMP9 protein sequence revealed that BMP9,in contrast to other osteogenic BMPs such as BMP2,completely lacks so-called heparin binding motifs that enable extracellular matrix(ECM)interactions which in general might be essential for the BMPs’osteogenic function.Therefore,we genetically engineered a new BMP9 variant by adding BMP2-derived heparin binding motifs to the N-terminal segment of BMP9′s mature part.The resulting protein(BMP9 HB)showed higher heparin binding affinity than BMP2,similar osteogenic activity in vitro and comparable binding affinities to BMPR-II and ALK1 compared to BMP9.However,remarkable differences were observed when BMP9 HB was adsorbed to collagen scaffolds and implanted subcutaneously in the dorsum of rats,showing a consistent and significant increase in bone volume and density compared to BMP2 and BMP9.Even at 10-fold lower BMP9 HB doses bone tissue formation was observed.This innovative approach of significantly enhancing the osteogenic properties of BMP9 simply by addition of ECM binding motifs,could constitute a valuable replacement to the commonly used BMPs.The possibility to use lower protein doses demonstrates BMP9 HB’s high translational potential.
基金financially supported by the National Natural Science Foundation of China (Nos.52170155 and 52100084)。
文摘Piezocatalytic activation of persulfate(PS) has great application potential in environmental remediation;however,the relationship between piezocatalyst thickness and catalytic activity is not clear,limiting the further improvement of catalytic activity and application of the technology.Herein,the Bi_(2)Fe_(4)O_(9)(BFO) piezocatalysts with tunable thickness were prepared through a facile hydrothermal method by tuning the molar ratio of Bi(NO_(3)),5H_(2)O and FeCl_(3)·6H_(2)O for piezocatalytic activation of peroxydisulfate(PDS).The BFO with the smallest thickness exhibits excellent catalytic activity,and the SO_(4)^(·-)and ·OH are the major reactive oxygen species for degrading organic pollutants.Further XPS investigations and finite element analyses demonstrate that the decreased thickness of BFO not only exposes more Fe^(2+)sites for PDS activation,but also improve the piezoelectric effect to accelerate the regeneration of Fe^(2+),thus enabling an enhanced synergy effect between PDS activation and piezocatalysis for outstanding catalytic activity.This work provides an understanding of the relationship between thickness of piezocatalysts and its catalytic activity over PDS activation,facilitating the development of more efficient piezocatalysts and PS-based advanced oxidation processes.
基金supported by National Natural Science Foundation of China(31672586 and 31830097)the Key Research and Development Program of Guangdong Province(2019B020218004)+2 种基金Earmarked Found for China Agriculture Research System(CARS-41-G16)Guangdong Province Universities and Colleges Pearl River Scholar Funded Scheme(2018,Wenbao Qi)Young Scholars of Yangtze River Scholar Professor Program(2019,Wenbao Qi)
文摘Since mid-2016,the low pathogenic H7N9 influenza virus has evolved into a highly pathogenic(HP)phenotype in China,raising many concerns about public health and poultry industry.The insertion of a“KRTA”motif at hemagglutinin cleavage site(HACS)occurred in the early stage of HP H7N9 variants.During the co-circulation,the HACS of HP-H7N9 variants were more polymorphic in birds and humans.Although HP-H7N9 variants,unlike the H5 subtype virus,exhibited the insertions of basic and non-basic amino acids,the underlying function of those insertions and substitutions remains unclear.The results of bioinformatics analysis indicated that the PEVPKRKRTAR/G motif of HACS had become the dominant motif in China.Then,we generated six H7N9 viruses bearing the PEIPKGR/G,PEVPKGR/G,PEVPKRKRTAR/G,PEVPKGKRTAR/G,PEVPKGKRIAR/G,and PEVPKRKRR/G motifs.Interestingly,after the deletion of threonine and alanine(TA)at HACS,the H7N9 viruses manifested decreased thermostability and virulence in mice,and the PEVPKRKRTAR/G-motif virus is prevalent in birds and humans probably due to its increased transmissibility and moderate virulence.By contrast,the insertion of non-basic amino acid isoleucine and alanine(IA)decreased the transmissibility in chickens and virulence in mice.Remarkably,the I335V substitution of H7N9 virus enhanced infectivity and transmission in chickens,suggesting that the combination of mutations and insertions of amino acids at the HACS promoted replication and pathogenicity in chickens and mice.The ongoing evolution of H7N9 increasingly threatens public health and poultry industry,so,its comprehensive surveillance and prevention of H7N9 viruses should be pursued.
基金supported by the Tianjin Synthetic Biotechnology Innovation Capacity Improvement Project (TSBICIP-CXRC-050 and TSBICIP-KJGG-004-20)the China Postdoctoral Science Foundation (2022M713329).
文摘CRISPR/Cas9-mediated homology-directed recombination is an efficient method to express target genes.Based on the above method,providing ideal neutral integration sites can ensure the reliable,stable,and high expression of target genes.In this study,we obtained a fluorescent transformant with neutral integration and high expression of the GFP expression cassette from the constructed GFP expression library and named strain FS.The integration site mapped at 4886 bp upstream of the gene FVRRES_00686 was identified in strain FS based on a Y-shaped adaptor-dependent extension,and the sequence containing 600 bp upstream and downstream of this site was selected as the candidate region for designing sgRNAs(Sites)for CRISPR/Cas9-mediated homology-directed recombination.PCR analysis showed that the integration efficiency of CRISPR/Cas9-mediated integration of target genes in designed sites reached 100%.Further expression stability and applicability analysis revealed that the integration of the target gene into the above designed sites can be stably inherited and expressed and has no negative effect on the growth of F.venenatum TB01.These results indicate the above designed neutral sites have the potential to accelerate the development of F.venenatum TB01 through overexpression of target genes in metabolic engineering.
