Technical Regulations for Production of Green Food--Adzuki Beans

According to the experiment and production practice,this paper brings forward the technical regulations on the production technology,the environmental conditions of production area,the output index,the site selection and land preparation,the variety selection and seed quality,the fertilization,the sowing,the field management,the pest and disease control,the harvesting,the storage,the filing etc. about the adzuki beans in Qingyang City.

Allelopathic Effects of Aqueous Extracts of Different Tissues and Rhizosphere Root of Adzuki Bean on Growth of Wheat Seedlings

Seedlings of wheat were used as receptor plants to study the allelopathic effects of Adzuki Bean aqueous extracts from different organs and rhizosphere soil at different concentrations （0, 10, 40 and 160 g/L） using sand culture of pot method. The results indicated that root aqueous extract of adzuki bean presented promotion effects at low concentrations and inhibition effects at the high concentra- tion on the growth of height and young leaf length of wheat seedlings, but inhibition effects at low concentrations and promotion effects at the high concentration on the growth of root length, the number of lateral roots and dry weigh of underground part of wheat seedlings. With the concentrations of rhizosphere soil, root, stem and leaf aqueous extracts of adzuki bean increasing, their inhibitory allelopathic effects on the growth of height and young leaf of wheat seedlings increased; the physiological parameters of wheat seedlings studied at the low concentrations of aqueous extracts, indicated that root and rhizosphere soil aqueous extracts of adzuki bean improved the activities of hyperoxid dismutase （SOD） and peroxide enzyme（POD）, but reduced the contents of chlorophyll and malonaldehyde （MDA）; the physiological parameters of wheat seedlings studied at the high concentration of aqueous extracts indicated that the leaf aqueous extract of adzuki bean inhibited root vigor, and reduced the contents of Chlorophyll and MDA, but it was found that the aqueous extract significantly improved the activities of SOD and POD; and as to the synthetic allelopathic effect （SE）, the allelopathic effects of different tissues and rhizosphere soil of adzuki bean on wheat seedlings were in order of leaf〉stem〉soil〉root.

Relations Between Photosynthetic Parameters and Seed Yields of Adzuki Bean Cultivars (Vigna angularis)

The study comparatively examined the leaf photosynthetic capacities of different adzuki bean cultivars, high-yield 2000-75 and Jihong 9218, and low-yield Hongbao 1 and Wanxuan 1 from flowering to ripening. It showed that after flowering, the leaves of the cultivars gradually aged, the leaf chlorophyll （Chl.）, soluble protein （SP） contents, net photosynthetic rates （Pn）, transpiration rates （Tr） and stomatal conductance （G） of the cultivars tended to decline, but the leaf intercellular CO2 concentration （Ci） of the cultivars tended to rise. The leaf photosynthetic capacities of the cultivars decreased gradually from the lower to the upper nodes. The dry seed yields of the cultivars were positively correlated with their leaf Chl., SP, Pn, and Tr and Gs, and negatively associated with their leaf Ci. At the late growth stages, the high-yield cultivars maintained higher leaf Chl. contents, SP contents, Pn, Tr, and Gs than the low-yield cultivars, indicating that leaf photosynthetic capacity was one of important yield-affecting factors of adzuki bean. Therefore, it was important for a crop at the crucial stage of yield formation to maintain a high leaf chlorophyll content and a high leaf photosynthetic capacity and delay leaf aging.

Effects of drought stress on root morphology and spatial distribution of soybean and adzuki bean

Due to global climate change,Korea is facing severe droughts that affect the planting and early vegetative periods of upland crops.Soybean and adzuki bean are important legume crops in Korea,so it is critical to understand their adaptations to water stress.This study investigated the changes in root morphological properties in soybean and adzuki bean and quantified the findings using fractal analysis.The experiment was performed at the National Institute of Crop Science in Miryang,Korea.Soybeans and adzuki beans were planted in test boxes and grown for 30 days.The boxes were filled with bed soil with various soil moisture treatments.Root images were obtained and scanned every two days,and the root properties were characterized by root length,depth and surface area,number of roots,and fractal parameters(fractal dimension and lacunarity).Root depth,length and surface area and the number of roots increased in both crops as the soil moisture content increased.The fractal dimension and lacunarity values increased as the soil moisture content increased.These results indicated that the greater the soil moisture,the more heterogeneous the root structure.Correlation analysis of the morphological properties and fractal parameters indicated that soybean and adzuki bean had different root structure developments.Both soybean and adzuki bean were sensitive to the amount of soil moisture in the early vegetative stage.Soybean required a soil moisture content greater than 70%of the field capacity to develop a full root structure,while adzuki bean required 100%of the field capacity.These results would be useful in understanding the responses of soybean and adzuki bean to water stress and managing irrigation during cultivation.

Effects of Exogenous Phthalic and Cinnamic Acids on Enzyme Activities and Microbial Community Structures in Rhizosphere Soil of Adzuki Bean

The aim of this study was to find out the effects of exogenous phenolic acids on soil microbes and enzymes in rhizosphere soil of adzuki bean. In the pot experiment of adzuki bean, phthalic and cinnamic acids were added at four concentrations, 0 （control）, 0.1, 1 and 10 mmol/L, to investigate the changes in the mi- croflora and enzyme activities in rhizosphere soil of adzuki bean as well as relations between them. The results showed that both phthalic and cinnamic acids could inhibit the activities of soil enzymes, including catalase, sucrase, phosphatase and urease. Higher concentrations （10 mmol/L） of phthalic and cinnamic acids showed more significant effects. In addition, the application of phthalic and cinnamic acids reduced the populations of bacteria and actinomycetes and significantly increased the population of fungi. Correlations analysis showed that phosphatase activity had an extremely significant positive correlation with bacterial population, a significant positive correlation with actinomycete population, and a significant negative correlation with fungal population. Phthalic and cinnamic acids could result in imbalanced microbe compositions, reduce enzyme activities and present evident allelopathy in rhizosphere soil.

Analysis of an Applied Core Collection of Adzuki Bean Germplasm by Using SSR Markers

Genetic diversity of 158 accessions of an applied core collection of adzuki bean （Vigna angularis） and 18 wild genotypes were assessed by using 85 microsatellite markers. With an average of 5.81 alleles per locus, 493 alleles were detected, and their distribution frequencies lower than 5% accounted for 73.02% of the total number. The distributions of alleles between the cultivated and the wild adzuki bean germplasm are different, with a higher allelic diversity in the wild germplasm than that of the cultivated ones. An obvious genetic differentiation was also observed between the wild and the cultivated adzuki beans, and SSR markers may be useful in study identification and classification of them. Among cultivated adzuki bean, the genetic similarity coefficient varied from 0.366 to 0.939. Genetic structure analysis can clearly separate the wild genotypes from the cultivated adzuki bean, and also can divide the cultivated ones into different populations, as these populations are closely agreeable with the ecological regions where they originally grow. The results of this study will be useful in arranging local breeding programs, especially in the aspect of parental combinations or identification of progenies. These SSR markers can also provide important information to explain the genetic relationship between the cultivated and wild adzuki beans, and to accelerate the wild gene resources in broadening the gene pool in breeding program.

The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.

Preliminary Study on Geographical Distribution and Evolutionary Relationships Between Cultivated and Wild Adzuki Bean (Vigna angular is var. angularis and var. nipponensis) by AFLP Analysis

A set of representative 146 adzuki (Vigna angular is var. angularis, and var. nipponensis) germplasm from 6 Asian countries traditionally for adzuki bean production, together with an out group standard rice bean (Vigna umbellata), were analyzed by AFLP methodology using 12 informative primer pairs. 313 unambiguous polymorphic bands were created. According to the dendrogram by cluster analysis based on AFLP banding, 143 of the accessions were distinct and revealed enough genetic diversity for identification and classification of accessions within Vigna angularis. A neighbor joining tree was generated using newly developed Innan's nucleotide diversity estimate from the AFLP data. From analysis, 7 distinct evolutionary groups, named as "Chinese cultivated", "Japanese cultivated", "Japanese complex-Korean cultivated", "Chinese wild", "China Taiwan wild", "Nepal-Bhutan cultivated" and "Hymalayan wild", were detected. Nucleotide diversity with geographical distribution of each group is discussed, regarding the evolutionary relationships between wild and cultivated adzuki beans. The preliminary results indicated that cultivated adzuki bean should be domesticated from at least 4 progenitors in at least 3 geographical origins.

Allelopathic Effect of Adzuki Bean Root Aqueous Extracts on Four Crops

For choosing suitable summer-planting adzuki bean crop, this experiment adopted the method of indoor petri dish bioassay to study the allelopathy effect of adzuki bean, radish, cabbage and wheat under different concentrations of adzuki bean root aqueous extracts. The result showed that the adzuki bean had a strong inhibition towards its germination rate and germination index. With the increasing concentration of the adzuki bean root aqueous extract, the seed germination rate and germination index of the three kinds of receptor crops presented a decreasing trend. From the root length, spire length, the number of lateral roots, plant height, fresh mass and other morphological indexes of seedlings, it was concluded that with the increase of concentration of adzuki bean root aqueous extract, only wheat pre- sented a promotion effect while the other two kinds of receptor crops showed an inhibition effect, which were not significant at low concentrations. With the increase of concentration of adzuki bean root extracts, the SOD and POD activities of radish and wheat also increased, while the two kinds of enzyme activities of cabbage showed a decreasing trend. The MDA contents in seedlings of radish and wheat decreased, while the MDA content in cabbage increased significantly, which showed that wheat could be used as a rotation crop of adzuki bean, and radish also had a great application potential in adzuki bean crop rotation.

Allelopathy Effect of Wheat Root Aqueous Extracts on Different Vigna angularis Varieties

Objective] This study aimed to investigate the al elopathy effect on the seed germination and seedling growth of different adzuki bean （Vigna angularis） vari-eties in wheat root aqueous extracts. [Method] Culture dish method and pot experi-ment were carried out with the seeds and the seedling of 10 adzuki bean varieties, respectively, and seed germination rate and various indexes of the seedlings were measured. [Result] ① 30 g/L wheat root aqueous extracts very significantly im-proved the germination rate and sprouting index of B1789, Baihong 3, Baohong 947. ② The genotype differences of adzuki bean seedling was presented by the morphological index in wheat root aqueous extracts treatment; among al the mor-phological indexes, Baohong 947, Jinhong 3 presented a positive al elopathic effect, and their plant height, root length and leaf area were extremely significantly in-creased, while the fresh weights of both above-ground and underground parts were increased obviously, compared with the control. ③ According to the synthetical al-lelopathic indices, wheat root aqueous extracts had different degrees of promoting effects on the six adzuki bean varieties： Baohong 947〉Baihong 6〉B1789〉Zunhua-hong〉Jihong〉Jinhong 3〉Baohong 8824-17〉Baihong 3. ④ Treated by wheat root aqueous extract, the SOD activity, POD activity, MDA content, TTC activity and chlorophyl content in the seedlings of adzuki beans of different genotypes changed by a smal er range in al elopathic promotion varieties than in al elopathic inhibition varieties. [Conclusion] The results proved that Baohong 947 is the best summer-planting variety after wheat.

Response of Four Dry Bean Market Classes to Pre-Emergence Applications of Pyroxasulfone, Sulfentrazone and Pyroxasulfone plus Sulfentrazone

Only one herbicide mode of action (ALS inhibitor) is currently available to Ontario dry bean producers for soil-applied broadleaf weed control. Four field studies were conducted over two years (2014, 2015) to examine the tolerance of four market classes of dry beans to sulfentrazone (210 and 420 g·ai·ha-1) and pyroxasulfone (100 and 200 g·ai·ha-1) applied alone and in combination. The registration of these two herbicides would provide Ontario dry bean producers with two additional modes of action for broadleaf weed control. Pyroxasulfone caused up to 23%, 6%, 7% and 10% injury in adzuki, kidney, small red Mexican and white bean, respectively;sulfentrazone caused up to 51%, 12%, 15% and 44% injury and the combination caused up to 90%, 23%, 29% and 62% injury, respectively. Kidney and small red Mexican bean density, height, seed moisture content and yield were not affected. Pyroxasulfone (200 g·ai·ha-1) + sulfentrazone (420 g·ai·ha-1) reduced adzuki and white bean density, shoot dry weight, height and yield. This study concludes that pyroxasulfone (100 g·ai·ha-1) + sulfentrazone (210 g·ai·ha-1) applied PRE can be safely used to control weeds in Ontario kidney and small red Mexican bean production.

Tolerance of Four Dry Bean Market Classes to Pre-Emergence Applications of Sulfentrazone

Ontario dry bean growers are currently limited to ALS inhibitor herbicides for soilapplied broadleaf weed control;therefore another mode of action is needed. Sulfentrazone is a PPO inhibitor herbicide that has activity on some annual grass and broadleaf weed species. Four field trials were conducted over two years (2014, 2015) to determine the tolerance of four commonly grown dry bean market classes (adzuki, kidney, small red Mexican and white bean) to PRE applications of sulfentrazone at 140, 210, 280 and 420 g·ai·ha-1. Crop injury, plant height, plant density, shoot biomass, seed moisture content and yield were examined. Sulfentrazone (420 g·ai·ha-1) caused up to 74%, 22%, 30%, and 57% injury in adzuki, kidney, small red Mexican and white bean, respectively. Plant density, height and yield were not reduced for kidney or small red Mexican bean. Sulfentrazone (420 g·ai·ha-1) reduced white bean plant density, height and yield by 28%, 29% and 29%, respectively;and reduced adzuki bean plant density, height and yield by 51%, 34% and 57%, respectively. Overall, kidney and small red Mexican bean were the most tolerant to sulfentrazone, followed by white bean, and then adzuki. This study determined sulfentrazone applied PRE is safe for Ontario kidney bean and small red Mexican bean crops.

Antioxidant and ACE inhibitory activities of peptides prepared from adzuki bean by semi-solid enzymatic hydrolysis

In this study,adzuki bean peptides were prepared by semi-solid enzymatic hydrolysis(SEH)and their antioxidant and Angiotensin-I-converting enzyme(ACE)inhibitory activities and internal absorption were studied.By modifying different enzymatic hydrolysis times and enzyme additions,the optimal enzymatic hydrolysis condition for SEH could be obtained as adzuki bean powder:water=4:1(w/w),alcalase:neutrase=2:1(w/w),enzyme addition 3.75%(w/w),4 h enzymatic hydrolysis at 50℃ and pH=8.Within these hydrolysis conditions,the content of adzuki bean peptides was 11.37%,the OH−scavenging rate of 1 mg/mL peptides was 72.75%,the total antioxidant capacity was 0.88±0.02 mmol/L FeSO4,the ACE inhibition rate was 77.49%.In vivo absorption test proved that the peptides prepared by SEH were absorbed faster and exhibited higher antioxidant activity compared with liquid enzymatic hydrolysis.In conclusion,the process of SEH can improve not only the efficiency of hydrolysis,but also the antioxidant and ACE inhibitory activity as well as the internal absorption of adzuki bean peptides.

Effect of fermentation with Monascus pilosus on the antioxidant activities and phenolic acid contents of adzuki bean(Vigna angularis)

Objective:To enhance physiological activities of adzuki bean(Vigna angularis)via fermentation with Monascus pilosus(M.pilosus).Methods:The adzuki bean fermentation conditions with M.pilosus were optimized,and the effect of Monascus-fermentation on the antioxidant capacity and phenolic acid contents of adzuki bean was investigated.Results:Optimal fermentation conditions were determined by the production of monacolin K.The highest monacolin K production was observed in 5%inoculum sized on day 15 in fermentation.Free and bound phenolic acids were isolated from native and fermented adzuki bean.A 1.9-fold decrease was observed in bound p-coumaric acid content,whereas the contents of bound ferulic and sinapic acids were increased by 28-and 1.7-fold,respectively.However,the contents of free phenolic acids such as p-coumaric,ferulic,and sinapic acids were increased by 2.6-,5.2-,and 7.2-fold,respectively.The fermentation of adzuki bean by M.pilosus enhanced the activities of DPPH■radical scavenging,ferrous ion-chelating,nitric oxide scavenging,and ferric antioxidant reducing activities 2.2-,1.7-,1.2-,and 1.8-fold,respectively.Conclusions:Results from our study suggest that the contents of p-coumaric,ferulic,and sinapic acids in adzuki bean were highly increased by fermentation with M.pilosus,resulting in enhanced various antioxidant activities.