Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far...Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far, several sufur-rich seed protein genes have been isolated and the essential amino acid contents of seed proteins were increased in transgenic tobacco and Brassica napus. In this paper we report the isolation and sequencing of the 10kd prolamin gene from seeds. Poly(A) RNA were prepared from the immature endosperms of japonica rice, Sachiminori, 10 d after flowering. Complementary DNAs were synthesized according to Promega Instruction Manual. Two primers were synthesized and their sequences were Primer Ⅰ: CGTCTACACCATCTGGAATC, Primer Ⅱ: GTGTTTGCAGATAGTATGC. The amplified fragraents were inserted into the Sma I site of pGEM-7zf(+) and was used to transform E. coli JM101 after PCR reaction. DNA sequence were determined by Sanger’s Chain-termination method. Synthesis of cDNA. Using mRNAs as展开更多
AIM: To investigate the dynamic features of insulin-like growth factor-I receptor (IGF-IR) expression in rat hepatocarcinogenesis, and the relationship between IGF-IR and hepatocytes malignant transformation at mRNA o...AIM: To investigate the dynamic features of insulin-like growth factor-I receptor (IGF-IR) expression in rat hepatocarcinogenesis, and the relationship between IGF-IR and hepatocytes malignant transformation at mRNA or protein level.METHODS: Hepatoma models were made by inducing with 2-fluorenylacetamide (2-FAA) on male Sprague-Dawley rats. Morphological changes of hepatocytes were observed by pathological Hematoxylin and eosin staining, the dynamic expressions of liver and serum IGF-IR were quantitatively analyzed by an enzyme-linked immunosorbent assay. The distribution of hepatic IGF-IR was located by immunohistochemistry. The fragments of IGF-IR gene were amplified by reverse transcription-polymerase chain reaction, and confirmed by sequencing.RESULTS: Rat hepatocytes after induced by 2-FAA were changed dynamically from granule-like degeneration, precancerous to hepatoma formation with the progressing increasing of hepatic mRNA or IGF-IR expression. The incidences of liver IGF-IR, IGF-IR mRNA, specific IGF-IR concentration (ng/mg wet liver), and serum IGF-IR level (ng/mL) were 0.0%, 0.0%, 0.63 ± 0.17, and 1.33 ± 0.47 in the control; 50.0%, 61.1%, 0.65 ± 0.2, and 1.51 ± 0.46 in the degeneration; 88.9%, 100%, 0.66 ± 0.14, and 1.92 ± 0.29 in the precancerosis; and 100%, 100%, 0.96 ± 0.09, and 2.43 ± 0.57 in the cancerous group, respectively. IGF-IR expression in the cancerous group was significantly higher (P < 0.01) than that in any of other groups at mRNA or protein level. The closely positive IGF-IR relationship was found between livers and sera (r = 0.91, t = 14.222, P < 0.01), respectively.CONCLUSION: IGF-IR expression may participate in rat hepatocarcinogenesis and its abnormality should be an early marker for hepatocytes malignant transformation.展开更多
Objective: Sequencing of mouse Tbx2 gene andobserving the expression of Tbx2 gene in normal andmalignant melanophore. Methods: The PCR productsof TbX2 cDNA were cloned into PUC18 vector andsequenced. The normal and ma...Objective: Sequencing of mouse Tbx2 gene andobserving the expression of Tbx2 gene in normal andmalignant melanophore. Methods: The PCR productsof TbX2 cDNA were cloned into PUC18 vector andsequenced. The normal and malignant melanocytes wereused to extract total RNA. The expression of Tbx2 genewas detected by RT-PCR. Results: The TbXZ genome iscomposed of seven e-cons and six nitrons. No expressionof Tbx2 gene in the normal melanocytes was noted, butall malignant melanocytes showed expression of TbXZgene. Conclusion: The observation showed the analysisof the genomic structure of mouse TbX2. TbX2 plays acritical role during the development of the malignantmelanophore.展开更多
Enhancers are DNA sequences that can strengthen transcription initiation.However,the global identification of plant enhancers is complicated due to uncertainty in the distance and orientation of enhancers,especially i...Enhancers are DNA sequences that can strengthen transcription initiation.However,the global identification of plant enhancers is complicated due to uncertainty in the distance and orientation of enhancers,especially in species with large genomes.In this study,we performed self-transcribing active regulatory region sequencing(STARR-seq)for the first time to identify enhancers across the barley genome.A total of 7323 enhancers were successfully identified,and among 45 randomly selected enhancers,over 75%were effective as validated by a dual-luciferase reporter assay system in the lower epidermis of tobacco leaves.Interestingly,up to 53.5%of the barley enhancers were repetitive sequences,especially transposable elements(TEs),thus reinforcing the vital role of repetitive enhancers in gene expression.Both the common active mark H3K4me3 and repressive mark H3K27me3 were abundant among the barley STARR-seq enhancers.In addition,the functional range of barley STARR-seq enhancers seemed much broader than that of rice or maize and extended to±100 kb of the gene body,and this finding was consistent with the high expression levels of genes in the genome.This study specifically depicts the unique features of barley enhancers and provides available barley enhancers for further utilization.展开更多
The outbreak of a novel influenza A(H1N1) virus across the globe poses a threat to human health.It is of paramount importance to develop a rapid,reliable and inexpensive diagnostic procedure.Based on the bioinformatic...The outbreak of a novel influenza A(H1N1) virus across the globe poses a threat to human health.It is of paramount importance to develop a rapid,reliable and inexpensive diagnostic procedure.Based on the bioinformatic information from public database,primers specific for influenza A virus surface protein haemagglutinin(HA) of several subtypes(including H1,H2,H3,H5,H7 and H9) were designed.Primer-specific PCR products were subjected to sequencing for accurately distinguishing H1 and H3 subtypes from others.This sequencing-based detection method will not only be applied to rapid detection and simultaneous subtype identification of new influenza A virus H1N1,but also provide the strategies to monitor other new types ofinfluenza virus with explosive potential.展开更多
文摘Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far, several sufur-rich seed protein genes have been isolated and the essential amino acid contents of seed proteins were increased in transgenic tobacco and Brassica napus. In this paper we report the isolation and sequencing of the 10kd prolamin gene from seeds. Poly(A) RNA were prepared from the immature endosperms of japonica rice, Sachiminori, 10 d after flowering. Complementary DNAs were synthesized according to Promega Instruction Manual. Two primers were synthesized and their sequences were Primer Ⅰ: CGTCTACACCATCTGGAATC, Primer Ⅱ: GTGTTTGCAGATAGTATGC. The amplified fragraents were inserted into the Sma I site of pGEM-7zf(+) and was used to transform E. coli JM101 after PCR reaction. DNA sequence were determined by Sanger’s Chain-termination method. Synthesis of cDNA. Using mRNAs as
基金Supported by The Society Development of Nantong,HS2012039Jiangsu Health Projects,BL2012053,K201102the Priority Academic Program Development of Jiangsu,and the International S and T Cooperation Program,2013DFA32150 of China
文摘AIM: To investigate the dynamic features of insulin-like growth factor-I receptor (IGF-IR) expression in rat hepatocarcinogenesis, and the relationship between IGF-IR and hepatocytes malignant transformation at mRNA or protein level.METHODS: Hepatoma models were made by inducing with 2-fluorenylacetamide (2-FAA) on male Sprague-Dawley rats. Morphological changes of hepatocytes were observed by pathological Hematoxylin and eosin staining, the dynamic expressions of liver and serum IGF-IR were quantitatively analyzed by an enzyme-linked immunosorbent assay. The distribution of hepatic IGF-IR was located by immunohistochemistry. The fragments of IGF-IR gene were amplified by reverse transcription-polymerase chain reaction, and confirmed by sequencing.RESULTS: Rat hepatocytes after induced by 2-FAA were changed dynamically from granule-like degeneration, precancerous to hepatoma formation with the progressing increasing of hepatic mRNA or IGF-IR expression. The incidences of liver IGF-IR, IGF-IR mRNA, specific IGF-IR concentration (ng/mg wet liver), and serum IGF-IR level (ng/mL) were 0.0%, 0.0%, 0.63 ± 0.17, and 1.33 ± 0.47 in the control; 50.0%, 61.1%, 0.65 ± 0.2, and 1.51 ± 0.46 in the degeneration; 88.9%, 100%, 0.66 ± 0.14, and 1.92 ± 0.29 in the precancerosis; and 100%, 100%, 0.96 ± 0.09, and 2.43 ± 0.57 in the cancerous group, respectively. IGF-IR expression in the cancerous group was significantly higher (P < 0.01) than that in any of other groups at mRNA or protein level. The closely positive IGF-IR relationship was found between livers and sera (r = 0.91, t = 14.222, P < 0.01), respectively.CONCLUSION: IGF-IR expression may participate in rat hepatocarcinogenesis and its abnormality should be an early marker for hepatocytes malignant transformation.
文摘Objective: Sequencing of mouse Tbx2 gene andobserving the expression of Tbx2 gene in normal andmalignant melanophore. Methods: The PCR productsof TbX2 cDNA were cloned into PUC18 vector andsequenced. The normal and malignant melanocytes wereused to extract total RNA. The expression of Tbx2 genewas detected by RT-PCR. Results: The TbXZ genome iscomposed of seven e-cons and six nitrons. No expressionof Tbx2 gene in the normal melanocytes was noted, butall malignant melanocytes showed expression of TbXZgene. Conclusion: The observation showed the analysisof the genomic structure of mouse TbX2. TbX2 plays acritical role during the development of the malignantmelanophore.
基金supported by the grants from the Key Program of Sichuan Province Natural Science Foundation(Grant No.2022NSFSC0015)the Key R&D Program of Sichuan Province(Grant Nos.2021YFN0034 and 2021YFG0028),China.
文摘Enhancers are DNA sequences that can strengthen transcription initiation.However,the global identification of plant enhancers is complicated due to uncertainty in the distance and orientation of enhancers,especially in species with large genomes.In this study,we performed self-transcribing active regulatory region sequencing(STARR-seq)for the first time to identify enhancers across the barley genome.A total of 7323 enhancers were successfully identified,and among 45 randomly selected enhancers,over 75%were effective as validated by a dual-luciferase reporter assay system in the lower epidermis of tobacco leaves.Interestingly,up to 53.5%of the barley enhancers were repetitive sequences,especially transposable elements(TEs),thus reinforcing the vital role of repetitive enhancers in gene expression.Both the common active mark H3K4me3 and repressive mark H3K27me3 were abundant among the barley STARR-seq enhancers.In addition,the functional range of barley STARR-seq enhancers seemed much broader than that of rice or maize and extended to±100 kb of the gene body,and this finding was consistent with the high expression levels of genes in the genome.This study specifically depicts the unique features of barley enhancers and provides available barley enhancers for further utilization.
文摘The outbreak of a novel influenza A(H1N1) virus across the globe poses a threat to human health.It is of paramount importance to develop a rapid,reliable and inexpensive diagnostic procedure.Based on the bioinformatic information from public database,primers specific for influenza A virus surface protein haemagglutinin(HA) of several subtypes(including H1,H2,H3,H5,H7 and H9) were designed.Primer-specific PCR products were subjected to sequencing for accurately distinguishing H1 and H3 subtypes from others.This sequencing-based detection method will not only be applied to rapid detection and simultaneous subtype identification of new influenza A virus H1N1,but also provide the strategies to monitor other new types ofinfluenza virus with explosive potential.
