Gene silencing:Double-stranded RNA mediated mRNA degradation and gene inactivation

The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.

Primer/Probe Optimization of RTq-PCR for Identification of Double-stranded （ds） RNA in Rhizoctonia solani

Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.

Host-induced silencing of MpPar6 confers Myzus persicae resistance in transgenic rape plants

Plant-mediated RNA interference(RNAi)has emerged as a promising technology for insect control.The green peach aphid,Myzus persicae,feeds on over 400 species of host plants.Brassica napus(rape)is the second most important oilseed crop worldwide.Myzus persicae is highly reproductive and causes severe damage to the rape plants due to its quite flexible life cycle.In this study,we tested the RNAi effects of transgenic rape plants on M.persicae.By in vitro feeding M.persicae with artificial diets containing double-stranded RNAs(dsRNAs)targeting seven aphid genes,we identified a new gene encoding the partitioning-defective protein 6(Par6)as the most potent RNAi target.Tissue-and stage-expression analysis of Par6 suggested this gene is highly expressed in the embryo and adult stage of M.persicae.We next generated transgenic rape plants expressing ds Par6 by Agrobacteriummediated transformation and obtained nine independent transgenic lines.Compared to wild-type control plants,transgenic rape lines expressing ds Par6 showed strong resistance to M.persicae.Feeding assays revealed that feeding transgenic rape plants to M.persicae significantly decreased MpPar6 expression and survival rate and impaired fecundity.Furthermore,we showed that the resistance levels to M.persicae are positively correlated with ds Par6 expression levels in transgenic rape plants.Our study demonstrates that transgenic rape plants expressing ds Par6 are efficiently protected from M.persicae.Interfering with the genes involved in embryo development could be the effective RNAi targets for controlling aphids and potentially other insect pests.

Identification, characterization and full-length sequence analysis of a novel endornavirus in common sunflower (Helianthus annuus L.)

To identify the possible quarantine viruses in seven common sunflower varieties imported from the United States of America and the Netherlands, we tested total RNAs extracted from the leaf tissues using next-generation sequencing of small RNAs. After analysis of small RNA sequencing data, no any quarantine virus was found, but a double-stranded RNA（dsRNA） molecule showing typical genomic features of endornavirus was detected in two varieties, X3939 and SH1108. Full-length sequence and phylogenetic analysis showed that it is a novel endornavirus, temporarily named as Helianthus annuus alphaendornavirus（HaEV）. Its full genome corresponds to a 14 662-bp dsRNA segment, including a 21-nt 5′ untranslated region（UTR）, 3＇ UTR ending with the unique sequence CCCCCCCC and lacking a poly（A） tail. An open reading frame（ORF） that encodes a deduced 4 867 amino acids（aa） polyprotein with three domains： RdRP, Hel and UGT（UDP-glycosyltransferase）. HaEV mainly distributed in the cytoplasm but less in the nucleus of leaf cells by fluorescence in situ hybridization（FISH） experiment. This virus has a high seed infection rate in the five varieties, X3907, X3939, A231, SH1108 and SR1320. To our knowledge, this is the first report about the virus of the family Endornaviridae in the common sunflower.

RNA interference in Colorado potato beetle(Leptinotarsa decemlineata): A potential strategy for pest control

Colorado potato beetle(CPB),Leptinotarsa decemlineata,is a notorious destructive pest that mainly feeds on the leaves of potato and several other solanaceous plants.CPB is widely recognized for its adaptation to a remarkable variety of host plants and diverse climates,and its high resistance to insecticides and Bacillus thuringiensis toxins.RNA interference(RNAi)is a sequence-specific,endogenous gene silencing mechanism evoked by small RNA molecules that is used as a robust tool for virus and pest control.RNAi has been extensively tested for CPB management by employing various target genes and delivery methods.This article reviews the screening of RNAi target genes,efficient RNAi delivery systems,and factors affecting RNAi efficiency in CPB,which may help understand the mechanisms of RNAi and its application in CPB control strategy.

Antitumor effect of RNA interference on non-small- cell lung cancer in vivo

Objective： Lung cancer has emerged as a leading cause of cancer death in the world. Current therapies are ineffective, thus new approaches are needed to improve the therapeutic ratio. RNA interference （RNAi） has shown promise in gene silencing in vitro, the potential of which in developing new methods for the therapy of non-small-cell lung cancer （NSCLC） needs to be further tested in vivo. In this study, chemically synthesized double-stranded RNA （dsRNA） targeting epidermal growth factor receptor （EGFR） was transfected into NSCLC cell line SPC-A1 cells and established the tumor burdened athymic nude mice model to investigate whether dsRNA could induce gene silencing in NSCLC cells in vivo. Methods： SPC-A1 was transfected with EGFR sequence-specific dsRNA formulated with Lipofectamine 2000. SPC-A1 cells （1 × 107/ mL） in 200 pL were injected s.c. into the left flank area of the mice to establish the tumor burdened athymic nude mice model. Calculate the tumor growth inhibition rate by measuring the diameter and the weight of the tumor. Immunohistochemistry and Westem blot were used to monitor the reduction in the production of the EGFR protein. Realtime RT-PCR was used to detect the silencing of the EGFR mRNA level. Results： It displayed that EGFR sequence specific dsRNA （dsRNA-EGFR） significantly inhibited the tumor growth in vivo. The tumor growth inhibition rate was 75.03%. The dsRNA-EGFR sequence specifically silenced EGFR with 53.6% of down-regulation of EGFR protein production and 32.3% of silencing of EGFR mRNA level. Conclusion： DsRNA-EGFR showed a blockbuster effect in downregulation of EGFR mRNA level and protein production, and inhibition of tumor growth in vivo.

Localization and function of a eukaryotic-initiation-factor-2-associated 67-kDa glycoprotein

AIM: To study the localization and function of a eukaryotic initiation factor 2 (eIF2α)-associated 67-kDa glycoprotein (p67).METHODS: Immunofluorescence staining,35S-Met/Cys metabolic labeling,Western blotting analysis,sucrose gradient centrifugation and high speed centrifugation were used to determine the localization of proteins in transiently transfected COS-1 cells.Transient co-transfection followed by co-immunoprecipitation was used to study the interaction between p67 and double-stranded RNA (dsRNA)-dependent protein kinase (PKR).Wheat germ agglutinin agarose beads were used to absorb glycosylated proteins.In vivo 32P-labeling followed by immunoprecipitation and Western blotting were used to measure PKR autophosphorylation,eIF2α phosphorylation,and p67 expression in normal and breast cancer cells.RESULTS: The image from immunofluorescence staining showed that p67 was overexpressed in the cytosol but not in the nucleus.In a sucrose gradient,approxi-mately 30% of the overexpressed p67 was bound with ribosomes.p67 interacted with the kinase domain,butnot the dsRNA-binding domains of PKR.Only the glycosylated p67 was associated with the ribosome,and p67 did not compete with PKR for ribosome binding.In breast cancer cells,there was increased autophosphorylation of PKR but no phosphorylation of eIF2α,compared with normal breast cells.α The ratio of glycosylated/deglycosylated p67 was altered in breast cancer cells.CONCLUSION: Glycosylation of p67 is required for its ribosomal association and can potentially inhibit PKR via interaction with the kinase domain of PKR.

RNA interference and its current application in mammals

Objective The aim of this review was to assess RNA interference (RNAi) and its possibility as a potential and powerful tool to develop highly specific double-stranded RNA ( dsRNA) or small interfering RNA (siRNA) based gene-silencing therapeutics. Data sources The data used in this review were obtained from the current RNAi-related research reports. Study selection dsRNA-mediated RNAi has recently emerged as a powerful reverse genetic tool to silence, gene expression in multiple organisms. The discovery that synthetic duplexes of 21 nucleotides siRNAs trigger gene-specific silencing in mammalian cells has further expanded the utility of RNAi in to the mammalian system. Data extraction The currently published papers reporting the discovery and mechanism of RNAi phenomena and application of RNAi on gene function in mammalian cells were included. Data synthesis Since the recent development of RNAi technology in the mammalian system, investigators have used RNAi to elucidate gene function, and to develop gene-based therapeutics by delivery exogenous siRNA or siRNA expressing vector. The general and sequence-specific inhibitory effects of RNAi that will be selective, long-term, and systemic to modulate gene targets mentioned in similar reports have caused much concern about its effectiveness in mammals and its eventual use as a therapeutic mordality. Conclusions It is certain that the ability of RNAi in mammals to silence specific genes, either when transfected directly as siRNAs or when generated from DNA vectors, will undoubtedly accelerate the study of gene function and might also be used as a potentially useful method to develop highly gene-specific therapeutic methods. It is also expected that RNAi might one day be used to treat human diseases.

RNA interference-mediated silencing of a Halloween gene spookier affects nymph performance in the small brown planthopper Laodelphax striatellus

Post-embryonic development of insects is highly dependent on ecdysteroid hormone 20-hydroxyecdysone. Halloween gene spookier （spok, cyp307a2） has been documented to be involved in ecdysteroidogenesis in Drosophila melanogaster and Bombyx mori. We describe here the cloning and characterization of Halloween gene spookier （Lsspok, Lscyp307a2） in the small brown planthopper Laodelphax striatellus, a hemipteran insect species. LsSPOK has three insect-conserved P450 motifs, that is, Helix-K, PERF motif and heme-binding domain. Temporal and spatial expression patterns of Lsspok were evaluated by quantitative polymerase chain reaction. Through the fouth- instar and the early fifth-instar stages, Lsspok showed two expression peaks in the second- and fifth-day fourth-instar nymphs, and two troughs in the first-day fourth and fifth in- stars. On day 5 of the fourth-instar nymphs, Lsspok clearly had a high transcript level in the thorax where prothoracic glands were located. Dietary introduction of double-stranded RNA of Lsspok in the nymph stage successfully knocked down the target gene, decreased expression level ofecdysone receptor （LsEcR） gene, caused nymphal lethality and delayed development. Ingestion of 20-hydroxyecdysone in Lsspok-dsRNA-exposed nymphs did not increase Lsspok expression level, but almost completely rescued the LsEcR mRNA level and relieved the negative effects on survival and development. Thus, our data suggest that the ecdysteroidogenic pathway is conserved in insects and LsSPOK is responsible for specific steps in ecdysteroidogenesis in L. striatellus.

RNA interference targeting ecdysone receptor blocks the larval-pupal transition in Henosepilachna vigintioctopunctata

Henosepilachna vigintioctopunctata is a serious insect pest which attacks a large number of nightshades and cucurbits in Asian countries,Brazil and Australia.Prolonged application of traditional pesticides has caused environmental pollution and exerted deleterious effects on human health.Finding new approaches with high target specificity and low environmental contamination has become an urgent task.RNA interference(RNAi)induced by double-stranded RNA(dsRNA)is expected to be applicable to managing this pest.Here we evaluated the effects of Escherichia co/Z-expressed dsRNAs targeting ecdvsone receptor(EcR)gene via dietary delivery in laboratory and foliar spraying in a greenhouse.The target transcript was successfully knocked down when the 4th-instar larvae had fed on potatofoliage dipped with dsEcR in a laboratory bioassay.Around 85%of the HvEcR RNAi larvae remained as prepupae or became abnormal pupae,and failed to emerge into adults.Ingestion of ds£c7?-immersed foliage by the 3rd-instar larvae effectuated a comparable RNAi response and brought about more severe defects:all the resultant larvae arrested development,remained as prepupae and finally died.For assay in the greenhouse,a ds£c7?-contained E.coli suspension was directly sprayed to the foliage of greenhouse-growing potato plants and the 3rd-and 4th-instar larvae were transferred to the leaves.High RNAi efficacy was obtained and identical RNAi phenotypes were observed in treated larvae.In addition,spraying dsEcR reduced leaf damage.Our results indicate a possibility of practical application of dsEcR as an environmentally friendly RNA pesticide to control H.vigintioctopunctata larvae.

RNAi technology for plant protection and its applicatior in wheat

The RNAi technology takes advantage of the intrinsic RNA interference(RNAi)mechanism that exists in nearly all eukaryotes in which target mRNAs are degraded or functionally suppressed.Significant progress has been made in recent years where RNAi technology is applied to several crops and economic plants for protection against diseases like fungi,pests,and nematode.RNAi technology is also applied in controlling pathogen damages in wheat,one of the most important crops in the world.In this review,we first give a brief introduction of the RNAi technology and the underneath mechanism.We then review the recent progress of its utilization in crops,particular wheat.Finally,we discuss the existing challenges and prospect future development of this technology in crop protection.

Predicting siRNA activity based on back-propagation neural network

RNA interference(RNAi)is a phenomenon of gene silence induced by a double-stranded RNA(dsRNA)homologous to a target gene.RNAi can be used to identify the function of genes or to knock down the targeted genes.In RNAi technology,19 bp double-stranded short interfering RNAs(siRNA)with characteristic 39 overhangs are usually used.The effects of siRNAs are quite varied due to the different choices in the sites of target mRNA.Moreover,there are many factors influencing siRNA activity and these factors are usually nonlinear.To find the motif features and the effect on siRNA activity,we carried out a feature extraction on some published experimental data and used these features to train a backpropagation neural network(BP NN).Then,we used the trained BP NN to predict siRNA activity.

Molecular cloning and characterization of the putative Halloween gene Phantom from the small brown planthopper Laodelphax striatellus

Ecdysteroid hormone 20-hydroxyecdysone plays fundamental roles in in- sect postembryonic development and reproduction. Several cytochrome P450 mono- oxygenases （CYPs）, encoded by the Halloween genes, have been documented to be involved in ecdysteroidogenesis in representative insects in Diptera, Lepidoptera and Orthoptera. Here the putative Halloween gene Phantom （Phm, cyp306al） from a hemipteran insect species, the small brown planthopper Laodelphax striatellus, was cloned. LsPHM shows five insect conserved P450 motifs, that is, Helix-C, Helix-I, Helix-K, PERF and heme- binding motifs. Temporal and spatial expression patterns of LsPhm were evaluated by quantitative polymerase chain reaction. Through the fourth-instar and the early fifth-instar stages, LsPhm showed two expression peaks in day 2 and days 4-5 fourth-instar nymphs, and three troughs in day 1 and 3 fourth instars and day 1 fifth instars. On day 5 of the fourth-instar nymphs, LsPhm clearly had a high transcript level in the thorax where the prothoracic glands were located. Dietary introduction of double-stranded RNA （dsRNA） of LsPhm at the nymph stage successfully knocked down the target gene, decreased expres- sion level ofecdysone receptor （LsEcR） gene and caused a higher nymphal mortality rate and delayed development. Ingestion of 20-hydroxyecdysone on LsPhm-dsRNA-exposed nymphs did not increase LsPhm expression level, but almost completely rescued the LsEcR mRNA level, and relieved the negative effects on survival and development. Thus, our data suggest that the putative LsPhm encodes a ftmctional 25-hydroxylase that catalyzes the biosynthesis of ecdysteroids in L. striatellus.