Highly specific selenium nanosystems for fluorescent image-guided rapid diagnosis and pathological grading of ovarian malignant tumors

Comprehensive surgical staging or optimal tumor cytoreductive surgery of malignant ovarian cancer directly affects disease prognosis.Therefore,a fluorescent selenium nanoparticle(Se@RGD/S2.2)decorated with cancer-targeting Arg-Gly-Asp(RGD)peptides and GCAGTTGATCCTTTGGATACCCTGG aptamer(S2.2)was developed for use as a diagnostic agent to achieve rapid,noninvasive diagnosis and visualization of microinvasive lesions during surgery for malignant ovarian cancer.

Self-confocal NIR-II fluorescence microscopy for multifunctional in vivo imaging

Fluorescence imaging in the second near-infrared window(NIR-II,900–1880 nm)with less scattering background in biological tissues has been combined with the confocal microscopic system for achieving deep in vivo imaging with high spatial resolution.However,the traditional NIR-IIfluorescence confocal microscope with separate excitation focus and detection pinhole makes it possess low confocal e±ciency,as well as di±cultly to adjust.Two types of upgraded NIR-IIfluorescence confocal microscopes,sharing the same pinhole by excitation and emission focus,leading to higher confocal e±ciency,are built in this work.One type is-ber-pinhole-based confocal microscope applicable to CW laser excitation.It is constructed forfluorescence intensity imaging with large depth,high stabilization and low cost,which could replace multiphotonfluorescence microscopy in some applications(e.g.,cerebrovascular and hepatocellular imaging).The other type is air-pinhole-based confocal microscope applicable to femtosecond(fs)laser excitation.It can be employed not only for NIR-IIfluorescence intensity imaging,but also for multi-channelfluorescence lifetime imaging to recognize different structures with similarfluorescence spectrum.Moreover,it can be facilely combined with multiphotonfluorescence microscopy.A single fs pulsed laser is utilized to achieve up-conversion(visible multiphotonfluorescence)and down-conversion(NIR-II one-photonfluorescence)excitation simultaneously,extending imaging spectral channels,and thus facilitates multi-structure and multi-functional observation.

Revisiting the standards of cancer detection and therapy alongside their comparison to modern methods

In accordance with the World Health Organization data,cancer remains at the forefront of fatal diseases.An upward trend in cancer incidence and mortality has been observed globally,emphasizing that efforts in developing detection and treatment methods should continue.The diagnostic path typically begins with learning the medical history of a patient;this is followed by basic blood tests and imaging tests to indicate where cancer may be located to schedule a needle biopsy.Prompt initiation of diagnosis is crucial since delayed cancer detection entails higher costs of treatment and hospitalization.Thus,there is a need for novel cancer detection methods such as liquid biopsy,elastography,synthetic biosensors,fluorescence imaging,and reflectance confocal microscopy.Conventional therapeutic methods,although still common in clinical practice,pose many limitations and are unsatisfactory.Nowadays,there is a dynamic advancement of clinical research and the development of more precise and effective methods such as oncolytic virotherapy,exosome-based therapy,nanotechnology,dendritic cells,chimeric antigen receptors,immune checkpoint inhibitors,natural product-based therapy,tumor-treating fields,and photodynamic therapy.The present paper compares available data on conventional and modern methods of cancer detection and therapy to facilitate an understanding of this rapidly advancing field and its future directions.As evidenced,modern methods are not without drawbacks;there is still a need to develop new detection strategies and therapeutic approaches to improve sensitivity,specificity,safety,and efficacy.Nevertheless,an appropriate route has been taken,as confirmed by the approval of some modern methods by the Food and Drug Administration.

Near-Infrared Fluorescence Imaging Contrast Agents for Clinical Research: Limitations and Alternatives

Introduction: Near-infrared fluorescence imaging is a technique that will establish itself in the short term at the international level because it is recognized for its potential to improve the performance of surgical interventions, its moderate investment and operating costs and its portability. Although the technology is now mature, there is currently the problem of the availability of contrast agents to be injected IV. The aim of this methodology article is to propose an alternative solution to the need for contrast agents for clinical research, particularly in oncology. Methodology: They consist of coupling a fluorescent marker in the form of an NHS derivative, such as IR DYE manufactured in compliance with GMP, with therapeutic monoclonal antibodies having marketing authorization for molecular imaging. For a given antibody, the marking procedure must be the subject of a validation file on the final preparation filtered on a sterilizing membrane at 0.22 μm. Once the procedure has been validated, it would be unnecessary to repeat the tests before each clinical research examination. A check of the marking by thin-layer chromatography (TLC) and place it in a sample bank at +4˚C for 1 month of each injected formulation would be sufficient for additional tests if necessary. Conclusion: Molecular near-infrared fluorescence imaging is experiencing development, the process of which could be accelerated by greater availability of clinical contrast agents. Alternative solutions are therefore necessary to promote clinical research in this area. These methods must be shared to make it easier for researchers.

Fluorescence Microscopic Image Analysis of Nucleic Acids Based on The Capillary Flow Directed Assembly Ring of Neutral Red-nucleic Acid Supramolecular Complexes

It is critical to establish a direct and precise method with a high sensitivity and selectivity in analytical chemistry. In this research, making use of a well known phenomenon of capillary flow, we have proposed an image analysis method of nucleic acids at the price of a small amount of sample. When a droplet of the supramolecular complex solution, formed by neutral red and nucleic acids(NA) under an approximate neutral condition, was placed on the hydrophobic surface of dimethyl dichlorosilane pretreated glass slides, and it was evaporated, the supramolecular complex exhibited the periphery of the droplet due to the capillary effect, and accumulated there to form a red capillary flow directed assembly ring(CFDAR). A typical CFDAR has an outer diameter of (2 r ) about 1.18 mm and a ring width(2 δ ) of about 41 μm. Depending on the experimental conditions, a variety of CFDAR can be assembled. The experimental results are in agreement with our former theoretical discussion. It was found that when a droplet volume is 0.1 μL, the fluorescence intensity of the CFDAR formed by the NR NA is in proportion to the content of calf thymus DNA in the range of 0-0.28 ng, fish sperm DNA of 0-0.24 ng and yeast RNA of 0-0.16 ng with the limit of detection(3 σ ) of 1 7, 1.4 and 0.9 pg, respectively for the three nucleic acids.

Gold Nanostars-AIE Theranostic Nanodots with Enhanced Fluorescence and Photosensitization Towards Effective Image-Guided Photodynamic Therapy

Dual-functional aggregation-induced photosensitizers(AIE-PSs)with singlet oxygen generation(SOG)ability and bright fluorescence in aggregated state have received much attention in image-guided photodynamic therapy(PDT).However,designing an AIE-PS with both high SOG and intense fluorescence via molecular design is still challenging.In this work,we report a new nanohybrid consisting of gold nanostar(AuNS)and AIE-PS dots with enhanced fluorescence and photosensitization for theranostic applications.The spectral overlap between the extinction of AuNS and fluorescence emission of AIE-PS dots(665 nm)is carefully selected using five different AuNSs with distinct localized surface plasmon(LSPR)peaks.Results show that all the AuNS s can enhance the 1 O2 production of AIE-PS dots,among which the AuNS with LSPR peak at 585 nm exhibited the highest 1 O2 enhancement factor of15-fold with increased fluorescence brightness.To the best of our knowledge,this is the highest enhancement factor reported for the metalenhanced singlet oxygen generation systems.The Au585@AIE-PS nanodots were applied for simultaneous fluorescence imaging and photodynamic ablation of HeLa cancer cells with strongly enhanced PDT efficiency in vitro.This study provides a better understanding of the metal-enhanced AIE-PS nanohybrid systems,opening up new avenue towards advanced image-guided PDT with greatly improved efficacy.

EPR Effect of Amphiphilic Copolymer Micelles Observed by Fluorescent Imaging

Enhanced permeation and retention（EPR） targeting effect of rhodamine B labeled PEG-b-P（LA-co-DHP） [PEG：poly（ethylene glycol）;LA：L-lactide;DHP：2,2-dihydroxylmethyl-propylene carbonate] micelles（RhB-micelles） was observed in H22 liver cancer bearing mice.The RhB-micelles were prepared by conjugating rhodamine B with the DHP units of amphiphilic block copolymer PEG-b-P（LA-co-DHP） followed by subsequent self-assembling of the conjugate.The parent copolymer PEG-b-P（LA-co-DHP） was synthesized by ring-opening copolymerization of LA and DHP with PEG as macroinitiator and diethyl zinc（ZnEt2） as catalyst.The micelles have a spherical shape and the average diameter is ca.50 nm by TEM（transmission electron microscope） or 80 nm by DLS（dynamic light scattering）.Their in vitro cell uptake experiment by CLSM（confocal laser scanning microscopy） and flow cytometry showed preferential internalization of micelles by MCF-7 human breast cancer cells to free RhB.The in vivo tests by live animal imaging and ex vivo excised organ imaging showed that after vena tail injection,free RhB molecules were distributed in the whole body through the circulation system and then gradually metabolized and excreted and there was no preferential partition in tumor bed from the beginning to the end.But the RhB-micelles were preferentially distributed to the tumor bed so that their concentration（fluorescent intensity） in tumor bed got the level of the liver at a certain time point between 1 and 6 h and reached a maximum relative intensity at around 12 h,indicating an obvious EPR effect of RhB-micelles in H22 liver cancer.

Fluorescence lifetime imaging of fluorescent proteins as an effective quantitative tool for noninvasive study of intracellular processes

Fluorescence litime imaging(FLIM)is an effective noninvasive bioanalytical tol based onmeasuring fuorescent lifetime of fuorophores.A growing number of FLIM studies utilizes ge-netically engineered fluorescent proteins targeted to specific subcellular structures to probe localmolecular environment,which opens new directions in cell science.This paper highlights theunconventional applications of FLIM for studies of molecular processes in diverse organelles oflive cultured cells.

Multifunctional magnetic nanoparticles for magnetic resonance image-guided photothermal therapy for cancer

Key advances in multifunctional magnetic nanoparticles （MNPs） for magnetic resonance （MR） image-guided pho- tothermal therapy of cancer are reviewed. We briefly outline the design and fabrication of such multifunctional MNPs. Bimodal image-guided photothermal therapies （MR/fluorescence and MR/ultrasound） are also discussed.

Fluorescent antibiotics for real-time tracking of pathogenic bacteria

The harm of pathogenic bacteria to humans has promoted extensive research on physiological processes of pathogens,such as the mechanism of bacterial infection,antibiotic mode of action,and bacterial antimicrobial resistance.Most of these processes can be better investigated by timely tracking of fluorophore-derived antibiotics in living cells.In this paper,we will review the recent development of fluorescent antibiotics featuring the conjugation with various fluorophores,and focus on their applications in fluorescent imaging and real-time detection for various physiological processes of bacteria in vivo.

ESTABLISHMENT OF VISIBLE ANIMAL METASTASIS MODELS FOR HUMAN NASOPHARYNGEAL CARCINOMA BASED ON A FAR-RED FLUORESCENT PROTEIN

Background and aims:The spectral properties of enhanced greenfluorescent protein(EGFP)used in current visualizable animal models for nasopharyngeal carcinoma(NPC)result in a limited imaging depth.Far-redfluorescent proteins have optimal spectral wavelengths that allow deep tissue penetration,thus are well-suited for the imaging of tumor growth and metastases in live animals.This study aims to establish an imageable animal model of NPC using far-redfluorescent proteins.Methods:Eukaryotic expression vectors of far-redfluorescent proteins,mLumin and Katushka S158A,were separately transfected into 5-8F NPC cells,and cell lines stably expressing the far-redfluorescent proteins were obtained.These cells were intraperitoneally or intravenously injected into mice,and their tumorigenic and metastatic potential were examined throughfluorescence imaging.Finally,factors affecting their tumorigenic ability were further assessed through testing side population(SP)cells proportion byflow cytometry.Results:NPC cell line with high tumorigenicity and metastasis(5-8F-mL2)was screened out,which stably expressed far-redfluorescent protein.Intraperitoneal and intravenous injection of 5-8F-mL2 cells resulted in an abdomen metastasis model and a lung metastasis model.In addition,NPC cell line without tumorigenicity(5-8F-Katushka S158A)was screened out.The percentage of SP cells between 5-8F-mL2 and 5-8F-Katushka S158A was found different,suggesting that the SP cell proportion may play a key role in the determination of cell tumorigenic ability.Conclusion:We successfully established animal models for NPC with high tumorigenicity and metastasis using a super-bright far-redfluorescent protein.Owing to the super-brightness and excellent wavelength parameters,these models may be applied as useful tools for intuitive and efficient monitoring of tumor growth and metastasis,as well as assessing the efficacy of nasopharyngeal cancer drugs.

Repeated laparoscopic liver resection using ICG fluorescent imaging for recurrent liver cancer

Objective:Liver cancer is very common in China,with cumulative five-year tumor recurrence rate after a microscopically margin-negative resection of hepatocellular carcinoma up to 70%.Postoperative recurrent hepatocellular carcinoma presents a challenge for surgeons because of the complexity of postoperative adhesion and the difficulty in of recognizing recurrent lesions.This study aims to introduce a method using an indocyanine green(ICG)fluorescent imaging technique to do repeated laparoscopic liver resection.Method:Patients received repeated laparoscopic liver resection using ICG fluorescent imaging between January 2017 and December 2019 in the Department of General Surgery of Sir Run Run Shaw Hospital were analyzed retrospectively.Basic information,intraoperative information,complications,and followup time were collected and analyzed.Results:Totally,35 patients with a median age of 59 years(ranged 38-82 years)were included.All of the patients received minimally invasive surgery.One case was performed robotically,and only two cases were converted to open surgery due to severe adhesion.The median operating time was 174 minutes,and the median blood loss during surgery was 100 mL.The median hospital stay after surgery was 5 days,with a range of 3e55 days.In total,32(91.4%)patients showed staining by ICG fluorescent imaging,and lesions were visible on fluorescent camera.The median follow-up time was 19.7 months,with a range of 1e40.2 months.The median relapse-free survival time was 18.5 months.Conclusion:Repeated laparoscopic liver resection using ICG fluorescent imaging is a safe and promising approach in the treatment of recurrent liver tumors in selected patients.

Deep learning method for cell count from transmitted-light microscope

Automatic cell counting provides an effective tool for medical research and diagnosis.Currently,cell counting can be completed by transmitted-light microscope,however,it requires expert knowledge and the counting accuracy which is unsatisfied for overlapped cells.Further,the image-translation-based detection method has been proposed and the potential has been shown to accomplish cell counting from transmitted-light microscope,automatically and effectively.In this work,a new deep-learning(DL)-based two-stage detection method(cGAN-YOLO)is designed to further enhance the performance of cell counting,which is achieved by combining a DL-based fluorescent image translation model and a DL-based cell detection model.The various results show that cGAN-YOLO can effectively detect and count some different types of cells from the acquired transmitted-light microscope images.Compared with the previously reported YOLO-based one-stage detection method,high recognition accuracy(RA)is achieved by the cGAN-YOLO method,with an improvement of 29.80%.Furthermore,we can also observe that cGAN-YOLO obtains an improvement of 12.11%in RA compared with the previously reported image-translation-based detection method.In a word,cGAN-YOLO makes it possible to implement cell counting directly from the experimental acquired transmitted-light microscopy images with high flexibility and performance,which extends the applicability in clinical research.

Indocyanine green dye and its application in gastrointestinal surgery:The future is bright green

Indocyanine green(ICG)is a water-soluble fluorescent dye that is minimally toxic and widely used in gastrointestinal surgery.ICG facilitates anatomical identi-fication of structures(e.g.,ureters),assessment of lymph nodes,biliary mapping,organ perfusion and anastomosis assessment,and aids in determining the adequacy of oncological margins.In addition,ICG can be conjugated to artificially created antibodies for tumour markers,such as carcinoembryonic antigen for colorectal,breast,lung,and gastric cancer,prostate-specific antigen for prostate cancer,and cancer antigen 125 for ovarian cancer.Although ICG has shown promising results,the optimization of patient factors,dye factors,equipment,and the method of assessing fluorescence intensity could further enhance its utility.This review summarizes the clinical application of ICG in gastrointestinal surgery and discusses the emergence of novel dyes such as ZW-800 and VM678 that have demonstrated appropriate pharmacokinetic properties and improved target-to-background ratios in animal studies.With the emergence of robotic technology and the increasing reporting of ICG utility,a comprehensive review of clinical application of ICG in gastrointestinal surgery is timely and this review serves that aim.

Development of water-soluble AIE-based wash-free Aβprobes superior to commercial ThT

Alzheimer's disease(AD)is a typical neurodegenerative disease.β-amyloid(AβÞplaque is the most prominent pathological biomarker associated with the progression of AD.Conventional Aβprobes,including commercial probe ThT,usually suffer from tedious washing procedures.Herein,novel AIE-active Aβprobes with excellent water solubility,named DE-V1-PYC3 and DE-V1-PYOH,were developed for the detection and image of Aβwithout tedious washing procedures.Compared with commercial probe ThT,the AIE-active Aβprobes exhibited better sensitivity and a±nity to Aβaggregates.Moreover,for ThT,the washing procedures are essential to obtain high signal-to-noise ratio(SNR)images of Aβplaques in AD brain tissue slices.DE-V1-PYC3 and DE-V1-PYOH can label Aβplaques in AD brain tissue slices with high SNR even without tedious washing procedures.

Automated apoptosis identification in fluorescence imaging of nucleus based on histogram of oriented gradients of high-frequency wavelet coefficients

The automatic and accurate identification of apoptosis facilitates large-scale cell analysis.Most identification approaches using nucleus fluorescence imaging are based on specific morphological parameters.However,these parameters cannot completely describe nuclear morphology,thus limiting the identification accuracy of models.This paper proposes a new feature extraction method to improve the performance of the model for apoptosis identification.The proposed method uses a histogram of oriented gradient(HOG)of high-frequency wavelet coefficients to extract internal and edge texture information.The HOG vectors are classified using support vector machine.The experimental results demonstrate that the proposed feature extraction method well performs apoptosis identification,attaining 95:7% accuracy with low cost in terms of time.We confirmed that our method has potential applications to cell biology research.

Compact and robust dual-color linearly polarized illumination source for three-photon fluorescence imaging

The miniaturized femtosecond laser in near infrared-Ⅱregion is the core equipment of threephoton microscopy.In this paper,we design a compact and robust illumination source that emits dual-color linearly polarized light for three-photon microscopy.Based on an all-polarizationmaintaining passive mode-locked fiber laser,we shift the center wavelength of the pulses to the 1.7m band utilizing cascade Raman effect,thereby generate dual-wavelength pulses.To enhance clarity,the two wavelengths are separated through the graded-index multimode fiber.Then we obtain the dual-pulse sequences with 1639.4 nm and 1683.7 nm wavelengths,920 fs pulse duration,and 23.75 MHz pulse repetition rate.The average power of the signal is 53.64mW,corresponding to a single pulse energy of 2.25 nJ.This illumination source can be further amplified and compressed for three-photon fluorescence imaging,especially dual-color three-photon fluorescence imaging,making it an ideal option for biomedical applications.

Minimally invasive surgery for gastro-oesophageal junction adenocarcinoma: Current evidence and future perspectives

Minimally invasive surgery is increasingly indicated in the management of malignant disease.Although oesophagectomy is a difficult operation,with a long learning curve,there is actually a shift towards the laparoscopic/thoracoscopic/robotic approach,due to the advantages of visualization,surgeon comfort(robotic surgery)and the possibility of the whole team to see the operation as well as and the operating surgeon.Although currently there are still many controversial topics,about the surgical treatment of patients with gastro-oesophageal junction(GOJ)adenocarcinoma,such as the type of open or minimally invasive surgical approach,the type of oesophago-gastric resection,the type of lymph node dissection and others,the minimally invasive approach has proven to be a way to reduce postoperative complications of resection,especially by decreasing pulmonary complications.The implementation of new technologies allowed the widening of the range of indications for this type of surgical approach.The short-term and long-term results,as well as the benefits for the patient-reduced surgical trauma,quick and easy recovery-offer this type of surgical treatment the premises for future development.This article reviews the updates and perspectives on the minimally invasive approach for GOJ adenocarcinoma.

Cisplatin-appended BODIPY for near infraredⅡfluorescent and photoacoustic imaging-guided synergistic phototherapy and chemotherapy of cancer

Combining phototherapy and chemotherapy has been considered a promising modality for cancer therapy due to their synergistic effect.Herein,we developed three D-π-A-structured boron dipyrromethenes(BODIPYs)(named as B-B,B-C,and B-C-Pt).Due to their enlargedπ-conjugated structure and high intramolecular charge transfer effect,the synthesized BODIPYs had photothermal conversion capability,and their absorption and fluorescence spectra were red-shifted.The cisplatin-appended BODIPY(B-C-Pt)exhibited good singlet oxygen(^1O_(2))generation ability and near infrared(NIR)absorption and fluorescence(λ_(Abs)=748 nm,λ_(Em)=947 nm).After being encapsulated by distearoyl phosphoethanolamine polyethyleneglycol 2000(DSPE-PEG-2000),which could inhibit the H-aggregation of B-C-Pt,the absorption and fluorescence of the obtained B-C-Pt nanoparticles(NPs)were red-shifted to 762 and 985 nm,respectively.The^1O_(2)quantum yield and photothermal conversion efficiency of the B-C-Pt NPs were 4.0%and 40.6%,respectively.Moreover,B-C-Pt NPs had chemotherapeutic efficacy due to the presence of cisplatin.In vitro and in vivo studies further demonstrated that B-C-Pt NPs had synergistic therapeutic efficacy.Together,B-C-Pt NPs could be employed in NIRⅡfluorescent and photoacoustic imaging-guided synergistic phototherapy and chemotherapy for cancer treatment.

Probing mitochondrial damage using a fluorescent probe with mitochondria-to-nucleolus translocation

Mitochondrial damage is closely related to the occurrence of many diseases.However,accurate monitoring and reporting of mitochondrial damage are not easy.Here,we developed a small molecule fluorescent probe named CB-Cl,which has splendid spectral properties(large Stokes shift,strong affinity for RNA,etc.)and excellent targeting ability to intracellular mitochondria.After mitochondria were damaged by external stimuli,CB-Cl would light up the nucleolus as a signal reporter.The cascade imaging of mitochondria and nucleolus using CB-Cl can monitor and visualize the mitochondrial status in living cells in real-time.Based on the above advantages,the probe CB-Cl has reference significance for the related research of mitochondrial damage and the prevention and treatment of related diseases.