This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
In the perifused fura-2 loaded exocrine pancreatic acinar cell line AR4-2J pulses of high potassium induced repetitive increases in intracellular calcium. Attached cells when stimulated with high potassium secreted la...In the perifused fura-2 loaded exocrine pancreatic acinar cell line AR4-2J pulses of high potassium induced repetitive increases in intracellular calcium. Attached cells when stimulated with high potassium secreted large amount of amylase. High potassium-induced secretion was dependent both on the concentration of potassium and duration of stimulation. High potassium induced increases in intracellular calcium were inhibited by voltage-dependent calcium channel antagonists with an order of potency as follows: nifedipine > ω-agatoxin IVA > ω-conotoxin GVIA. In contrast, the L-type calcium channel antagonist nifedipine almost completely inhibited potassium-induced amylase secretion, whereas the N-type channel antagonist ω-conotoxin GVIA was without effect. The P-type channel antagonist ω-agatoxin IVA had a small inhibitory effect, but this inhibition was not significant at the level of amylase secretion. In conclusion, the AR4-2J cell line possesses different voltage-dependent calcium channels (L, P,N) with the L-type predominantly involved in depolarization induced amylase secretion.展开更多
The authors described a novel submerged batch culture system that produced high levels of amylase by Aspergillus kawachii using whole barley （WB）, the surface of which is covered by its husk. In this study, detailed...The authors described a novel submerged batch culture system that produced high levels of amylase by Aspergillus kawachii using whole barley （WB）, the surface of which is covered by its husk. In this study, detailed analyses determining the amylase activities, residual sugars, fungal morphology and expression levels of genes were performed in a submerged culture using WB to address the mechanism underlying high amylase productivity in A. kawachii. High levels of glucoamylase and acid-stable u-amylase were produced in this culture, and expression levels of amylases, as well as glucose-repressive genes including high-affinity glucose transporter and peroxidase/catalase were also high. On the other hand, the morphology of mycelia was altered, with swollen, bulbous, multi-septum hyphae and conidiophores that normally form in a solid culture being partially generated. Furthermore, cell cycle and post-translational modification-related gene expression levels were altered, and were similar to those in the solid culture. These findings suggest that high amylase productivity in the submerged culture using WB is accompanied by both the up-regulation of amylase genes and activation of post-translational modifications due to fungal morphological changes being brought closer to those in the solid culture.展开更多
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
文摘In the perifused fura-2 loaded exocrine pancreatic acinar cell line AR4-2J pulses of high potassium induced repetitive increases in intracellular calcium. Attached cells when stimulated with high potassium secreted large amount of amylase. High potassium-induced secretion was dependent both on the concentration of potassium and duration of stimulation. High potassium induced increases in intracellular calcium were inhibited by voltage-dependent calcium channel antagonists with an order of potency as follows: nifedipine > ω-agatoxin IVA > ω-conotoxin GVIA. In contrast, the L-type calcium channel antagonist nifedipine almost completely inhibited potassium-induced amylase secretion, whereas the N-type channel antagonist ω-conotoxin GVIA was without effect. The P-type channel antagonist ω-agatoxin IVA had a small inhibitory effect, but this inhibition was not significant at the level of amylase secretion. In conclusion, the AR4-2J cell line possesses different voltage-dependent calcium channels (L, P,N) with the L-type predominantly involved in depolarization induced amylase secretion.
文摘The authors described a novel submerged batch culture system that produced high levels of amylase by Aspergillus kawachii using whole barley （WB）, the surface of which is covered by its husk. In this study, detailed analyses determining the amylase activities, residual sugars, fungal morphology and expression levels of genes were performed in a submerged culture using WB to address the mechanism underlying high amylase productivity in A. kawachii. High levels of glucoamylase and acid-stable u-amylase were produced in this culture, and expression levels of amylases, as well as glucose-repressive genes including high-affinity glucose transporter and peroxidase/catalase were also high. On the other hand, the morphology of mycelia was altered, with swollen, bulbous, multi-septum hyphae and conidiophores that normally form in a solid culture being partially generated. Furthermore, cell cycle and post-translational modification-related gene expression levels were altered, and were similar to those in the solid culture. These findings suggest that high amylase productivity in the submerged culture using WB is accompanied by both the up-regulation of amylase genes and activation of post-translational modifications due to fungal morphological changes being brought closer to those in the solid culture.
