BACKGROUND This study aimed to explore the relationship between gene mutations and early embryonic development arrest and to provide more possibilities for the diagnosis and treatment of repeated implantation failure....BACKGROUND This study aimed to explore the relationship between gene mutations and early embryonic development arrest and to provide more possibilities for the diagnosis and treatment of repeated implantation failure.CASE SUMMARY Here,we collected and described the clinical data of a patient with early embryonic development stagnation after repeated in vitro fertilization attempts for primary infertility at the Department Reproductive Center of Zaozhuang Maternal and Child Healthcare Hospital.We also detected the whole-exon gene of the patient's spouse and parents,and conducted bioinformatics analysis to determine the pathogenesis of the gene.CONCLUSION A novel mutant of the TUBB8 gene[c.602G>T(p.C201F)]was identified,and this mutant provided new data on the genotype-phenotype relationships of related diseases.展开更多
A new method for screening gene mutations by using a Coupled In Vitro Transcription and Translation System is reported in this paper. It includes the following steps: (1) The target DNA fragments with T7T1 sequence a...A new method for screening gene mutations by using a Coupled In Vitro Transcription and Translation System is reported in this paper. It includes the following steps: (1) The target DNA fragments with T7T1 sequence at its 5 prime end are amplified (T7T1: GGATCCTAATACGACTCTATAGGGAG ACCACCATG); (2) The RNA and peptide are synthesized and labeled from the PCR product in the coupled In Vitro Transcription-Translation System; (3) The produced peptides are analyzed by using SDS-PAGE and pH Gradient gel focusing electrophoresis. Four peptide products from 4 HB patients with nonsense mutation in Exon H of F IX gene show truncated protein bands with speeded migration in the autoradiography of the SDS-PAGE. Ten out of 11 HB patients with different missense mutations show abnormal patterns in the autoradiography of a pH 4-7 gradient gel focusing electrophoresis. Conclusion: The PCR and the Coupled In Vitro Transcription-Translation System/SDS-PAGE is a good method for proteins truncation test. The PCR and the Transcription-Translation System combined with pH gradient gel focusing electrophoresis is an efficient method for screening the abnormal protein products from DNA fragments with missense mutations.展开更多
基金Supported by the Shandong Provincial Traditional Chinese Medicine Science and Technology Development Program,No.C-262the 2021 Science and Technology Innovation Research Project of Shandong Maternal and Child Health Association,No.2021-19-24.
文摘BACKGROUND This study aimed to explore the relationship between gene mutations and early embryonic development arrest and to provide more possibilities for the diagnosis and treatment of repeated implantation failure.CASE SUMMARY Here,we collected and described the clinical data of a patient with early embryonic development stagnation after repeated in vitro fertilization attempts for primary infertility at the Department Reproductive Center of Zaozhuang Maternal and Child Healthcare Hospital.We also detected the whole-exon gene of the patient's spouse and parents,and conducted bioinformatics analysis to determine the pathogenesis of the gene.CONCLUSION A novel mutant of the TUBB8 gene[c.602G>T(p.C201F)]was identified,and this mutant provided new data on the genotype-phenotype relationships of related diseases.
文摘A new method for screening gene mutations by using a Coupled In Vitro Transcription and Translation System is reported in this paper. It includes the following steps: (1) The target DNA fragments with T7T1 sequence at its 5 prime end are amplified (T7T1: GGATCCTAATACGACTCTATAGGGAG ACCACCATG); (2) The RNA and peptide are synthesized and labeled from the PCR product in the coupled In Vitro Transcription-Translation System; (3) The produced peptides are analyzed by using SDS-PAGE and pH Gradient gel focusing electrophoresis. Four peptide products from 4 HB patients with nonsense mutation in Exon H of F IX gene show truncated protein bands with speeded migration in the autoradiography of the SDS-PAGE. Ten out of 11 HB patients with different missense mutations show abnormal patterns in the autoradiography of a pH 4-7 gradient gel focusing electrophoresis. Conclusion: The PCR and the Coupled In Vitro Transcription-Translation System/SDS-PAGE is a good method for proteins truncation test. The PCR and the Transcription-Translation System combined with pH gradient gel focusing electrophoresis is an efficient method for screening the abnormal protein products from DNA fragments with missense mutations.
