OsPLS4 encodes aβ-ketoacyl carrier protein reductase(KAR).The role of OsPLS4 in rice sheath blight(Rhizoctonia solani)remains unclear.Our preliminary studies showed that premature leaf senescence mutants(pls4)were hi...OsPLS4 encodes aβ-ketoacyl carrier protein reductase(KAR).The role of OsPLS4 in rice sheath blight(Rhizoctonia solani)remains unclear.Our preliminary studies showed that premature leaf senescence mutants(pls4)were highly susceptive to sheath blight in the early stage of rice development.To explore the role of this gene in the development of rice sheath blight,the transcriptome profiles of the rice pls4 mutant and wild type were compared by RNA-seq.The results revealed 2,569 differentially expressed genes(DEGs).The down-regulated genes were significantly enriched in the defense response-related biological processes.These down-regulated genes included the chitinase genes and WRKY genes,which were significantly changed in pls4 mutants.Furthermore,467 genes induced significant alternative splicing(AS)events.Among them,intron retention(IR)affected gene expression levels and functions of the vitamin B6(VB6)metabolism pathway related to sheath blight.This result suggests that IR plays an important role in the sheath blight resistance of mutant pls4.Together,these results indicate that pls4 could be involved in the biological process of sheath blight via DEGs and the fine-tuning of IR.The present study provides a molecular basis for further investigation of the resistance of rice to sheath blight.展开更多
There exists a single nucleotide polymorphism, G or T, at the first base of the donor splice site of waxy gene intron 1 in rice. In order to study the relationship between the first base of the donor splice site of wa...There exists a single nucleotide polymorphism, G or T, at the first base of the donor splice site of waxy gene intron 1 in rice. In order to study the relationship between the first base of the donor splice site of waxy gene intron 1 and amylose content in rice, the one-step PCR method was used to determine whether it is G or T in 220 Yunnan indigenous rice varieties from 14 districts, 55 towns/counties of Yunnan Province, and 101 varieties of which were validated by the PCR-Acc I method. According to the G/T polymorphism, 164 rice varieties showed GG-genotype, while the other 56 fell into TT- genotype, accounting for 74.5% and 25.5% of all the test varieties, respectively. When all the rice varieties were divided into indica and japonica subspecies, it was found that 80.5% of indica rice and 67.0% of japonica rice belonged to GG-genotype. The rice varieties with GG-genotype had significantly higher amylose content (18.95% on average) than those with TT- genotype (all below 16%), but 33 rice varieties with GG-genotype still had low amylose content ranging from 3.91% to 15.93%, and most of them came from the Dai minority area in the Southwest of Yunnan Province. However, there was no significant difference in the mean amylose content of the same GG or TT genotypes between indica and japonica rice, suggesting that different genetic backgrounds, indica or japonica, had no effect on amylose content. The coefficient of correlation between the genotype and amylose content was 0.733 (P〈0.01).展开更多
This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
AIM:To investigate p53 mutations in esophageal cancer in a high-risk population,and correlate them with smoking,alcohol consumption and betel chewing.METHODS:One hundred and sixty-five tumor samples of esophageal squa...AIM:To investigate p53 mutations in esophageal cancer in a high-risk population,and correlate them with smoking,alcohol consumption and betel chewing.METHODS:One hundred and sixty-five tumor samples of esophageal squamous cell carcinoma(ESCC) obtained from a university hospital in Songkhla province,Southern Thailand were investigated for p53 mutations in exons 5-8,using polymerase chain reaction-single strand conformation polymorphism analysis,followed by direct sequencing.A polymerase chain reactionrestriction fragment length polymorphism(RFLP) assay was additionally used to confirm possible germline mutation in intron 6.A history of risk habits was obtained by interviews.The association between risk habits and mutation frequency was evaluated using the χ 2 test.RESULTS:The studied specimens were from 139 male and 26 female patients with ESCC,treated at Songklanagarind Hospital.Most of the patients were smokers(86.7%) and alcohol consumers(72.73%),and 38.3% were betel chewers.Forty-three mutations of the p53 gene were detected in 25.5%(42/165) of tumor samples.Mutations were most commonly found in exon 5(25.6%) and exon 8(25.6%).Mutations in the hot-spot codon 248 were found in four cases(9.3% of all mutations).G:C→C:G(30.23%),G:C→A:T(27.90%) and G:C →T:A(16.28%) were the prevalent spectra of mutations.Unexpectedly,among 10 intronic mutations,eight cases harbored a similar mutation:G→C substitution in intron 6(nucleotide 12759,GenBank NC_000017).These were additionally confirmed by the RFLP technique.Similar mutations were also detected in their matched blood samples using RFLP and direct sequencing,which suggested germline mutations.There was no significant correlation between risk habits and p53 mutation frequency.CONCLUSION:A proportion of Thai ESCC patients harbored specific intronic p53 mutations,which might be germline mutations.Further studies are needed to explore this novel finding.展开更多
To develop a new DNA maker, which could be used in genetic diversity analysis and genetic map construction in plants, IT-ISJ (intron targeted intron-exon splice junction) primer combinations, which were designed acc...To develop a new DNA maker, which could be used in genetic diversity analysis and genetic map construction in plants, IT-ISJ (intron targeted intron-exon splice junction) primer combinations, which were designed according to the intronexon splice junction conserved sequences, were used to construct cotton genetic linkage map in the present study. 49 out of 704 IT-ISJ primer combinations showed polymorphism between upland cotton high quality cultivar Yumian 1 and multiple dominant gene line T586, and the polymorphic primer combinations accounted for 7.0% of total primer combinations. 49 IT-ISJ primer combinations were used to genotype 270 F2:7 recombinant inbred lines developed from (Yumian 1 × T586) F2, and 58 IT-ISJ loci were obtained. 58 IT-ISJ, together with 150 SSR and 8 morphological loci, were used to conduct linkage analysis, and a linkage map including 22 linkage groups and 113 loci (49 IT-ISJ, 62 SSR, and 2 morphological loci) was constructed. The linkage map covered 714.5 cM with an average interval of 6.3 cM between two markers, accounting for 16.1% of cotton genome. The present study demonstrated that the polymorphism of IT-ISJ marker is high, and it could be effectively applied in plant genetic map construction.展开更多
Lentil(Lens culinaris Medik) is one of the most important food legumes in the world. The use in lentil of molecular marker-assisted breeding is limited, owing to the low availability of polymorphic markers. In the pre...Lentil(Lens culinaris Medik) is one of the most important food legumes in the world. The use in lentil of molecular marker-assisted breeding is limited, owing to the low availability of polymorphic markers. In the present study, we developed a set of polymorphic intron-spanning markers(ISMs) using a cross-species mapping approach. In this approach, putative unique transcripts(PUTs) of L. culinaris were mapped onto the Medicago truncatula genome, exploiting its closeness with the lentil genome. Spliced alignment of the PUTs resulted in a total of 25,717 alignments, allowing the development of 1703 ISMs. From these, a subset of 105 ISMs were synthesized and validated with a 51% amplification success rate in 32 lentil genotypes. Of these ISMs, 40(74%) were polymorphic and generated 2–11 alleles per locus in a genetically diverse panel of 32 lentil genotypes including wild species.This set of polymorphic ISMs along with their functional annotation data will be useful in lentil breeding.展开更多
In this study,three weight vectors L1,L2 and L3 were set.After calculating the probability of three bases in the exons or introns in the genomic DNA of Arabidopsis thaliana,64-dimensional vector P was obtained.Dot pro...In this study,three weight vectors L1,L2 and L3 were set.After calculating the probability of three bases in the exons or introns in the genomic DNA of Arabidopsis thaliana,64-dimensional vector P was obtained.Dot products of P vector and three weight vectors were the feature coordinates for the exons and introns in 3-dimensional phase space.The expression for the interface between the exons and the introns in the genomic DNA of Arabidopsis thaliana in 3-dimensional phase space was established,which could be used to distinguish the exons and the introns in the genomic DNA of Arabidopsis thaliana with an accuracy higher than85%in 3-dimensional phase space.展开更多
A spintronics neuron device based on voltage-induced strain is proposed.The stochastic switching behavior,which can mimic the firing behavior of neurons,is obtained by using two voltage signals to control the in-plane...A spintronics neuron device based on voltage-induced strain is proposed.The stochastic switching behavior,which can mimic the firing behavior of neurons,is obtained by using two voltage signals to control the in-plane magnetization of a free layer of magneto-tunneling junction.One voltage signal is used as the input,and the other voltage signal can be used to tune the activation function(Sigmoid-like) of spin neurons.Therefore,this voltage-driven tunable spin neuron does not necessarily use energy-inefficient Oersted fields and spin-polarized current.Moreover,a voltage-control reading operation is presented,which can achieve the transition of activation function from Sigmoid-like to Re LU-like.A three-layer artificial neural network based on the voltage-driven spin neurons is constructed to recognize the handwritten digits from the MNIST dataset.For the MNIST handwritten dataset,the design achieves 97.75% recognition accuracy.The present results indicate that the voltage-driven adaptive spintronic neuron has the potential to realize energy-efficient well-adapted neuromorphic computing.展开更多
Although a great deal of research has been undertaken in the area of the annotation of gene structure, predictive techniques are still not fully developed. In this paper, based on the characteristics of base compositi...Although a great deal of research has been undertaken in the area of the annotation of gene structure, predictive techniques are still not fully developed. In this paper, based on the characteristics of base composition of sequences and conservative of nucleotides at exon/intron splicing site, a least increment of diversity al-gorithm (LIDA) is developed for studying and predicting three kinds of coding exons, introns and intergenic regions. At first, by selecting the 64 trinucleotides composition and 120 position parameters of the four bases as informational parameters, coding exon, intron and intergenic sequence are predicted. The results show that overall predicted accuracies are 91.1% and 88.4%, respectively for A. thaliana and C. ele-gans genome. Subsequently, based on the po-sition frequencies of four kinds of bases in regions near intron/coding exon boundary, initia-tion and termination site of translation, 12 position parameters are selected as diversity source. And three kinds of the coding exons are predicted by use of the LIDA. The predicted successful rates are higher than 80%. These results can be used in sequence annotation.展开更多
Pigmentation plays important adaptation and physiological efficiency roles in animals. In the sequence of a 648 bp fragment representing intron 1, exon 2, and part of intron 2 of the MLPH mammalian pigmentation gene, ...Pigmentation plays important adaptation and physiological efficiency roles in animals. In the sequence of a 648 bp fragment representing intron 1, exon 2, and part of intron 2 of the MLPH mammalian pigmentation gene, we identified a novel g.469C> G mutation in intron 2, and genotyped it in 266 Nigerian goats using PCR-RFLP analysis. The C allele had frequencies of 0.9625, 0.9804 and 0.97405 in West African Dwarf (WAD),Sahel(SH) and Red Sokoto (RS) breeds, respectively. The G allele was the highest in WAD (0.0375), followed by RS (0.02595), and then SH (0.0196). Overall low FIS and FST and high Nm values demonstrate little differentiation within and among the goat breeds at this intronic locus. This g.469C> G polymorphism in MLPH gene is the first in any goat breed and also first in Nigerian goats. Our results suggest that this intronic SNP locus is maintained at Hardy-Weinberg equilibrium (P < 0.05) and the lack of association of this SNP with coat color may indicate its neutrality in goats.展开更多
One of the features of intron-containing genes of the nxf (nuclear export factor) family in different organisms is the presence of an evolutionarily conserved exon-intron block: exon 110nt-intron-exon 37nt. The intron...One of the features of intron-containing genes of the nxf (nuclear export factor) family in different organisms is the presence of an evolutionarily conserved exon-intron block: exon 110nt-intron-exon 37nt. The intron in this evolutionarily conserved block, which we call a “cassette” intron, can be excised or retained in alternative transcripts of nxf1. It corresponds to intron 10 -11 inthe genes that are orthologous to nxf1 in vertebrates, and intron 5 -6 inthe genes that are orthologous to nxf1 in Drosophilidae. The alignment of sequences of cassette introns in nxf1 genes in vertebrates has revealed four evolutionarily conserved sequences: 1)5’flanking sequence, 2) a region containing СТЕ (constitutive transport element), 3) third conserved sequence, and 4)3’flanking sequence. Introns 5-6 of nxf1 in Drosophilidae have no similar conserved sequences. The results of sequence alignment demonstrate a similarity between cassette introns of nxf1 in Drosophilidae in two poly(A) sequences. The prevalence of Dm nxf1 transcripts containing cassette intron 5-6 under completely spliced transcripts in the heads of adult Drosophila melanogaster suggests a functional importance of transcripts that contain a retained intron. Evolutionary conservation, which in Drosophilidae is evident in the presence of poly(A) sequences in cassette introns of the nxf1 genes, is an adaptive feature: the poly(A) sequences are capable of mimicking the 3’-end of transcripts, promote transport from the nucleus to the cytoplasm, or are involved in NMD control. The ability to form characteristic secondary structures is a common feature of nxf1 cassette introns.展开更多
[ Objective] The aim of this paper is to provide the basic data for marker-assisted selection of pig breeding using porcine heart fatty acid- binding protein (H-FABP) gene. [Method] According to the related sequence...[ Objective] The aim of this paper is to provide the basic data for marker-assisted selection of pig breeding using porcine heart fatty acid- binding protein (H-FABP) gene. [Method] According to the related sequences of porcine H-FABP gene released in GenBank, specific primers were designed to amplify the intron 3 of porcine H-FABP gene. [ Result] The intron 3 of porcine H-FABP gene was amplified successfully. Its whole sequence was 1 350 bp in length and had been submitted to GenBank (Accession no. : DQ 002993). [Condusion] The study lays a theoretical foundation for determination of the major genes affecting intramuscular fat deposition.展开更多
Objective:To investigate the effects of Intron on the EMT capability of non-small cell lung cancer cell line PC-9.Methods:Firstly,using the psiCHECK-2 plasmid as a basic framework to construct the recombinant plasmid ...Objective:To investigate the effects of Intron on the EMT capability of non-small cell lung cancer cell line PC-9.Methods:Firstly,using the psiCHECK-2 plasmid as a basic framework to construct the recombinant plasmid of psiCHECK-2-Intron dual-luciferase reporter gene;secondly,the psiCHECK-2-Intron and psiCHECK-2 were transfected into PC-9 cells respectively.The migration and invasion abilities of PC-9 cells were analyzed by Matrigel assay.The expression changes of EMT related hallmarks,including N-cadherin,β-catenin and snail,were detected by qRT-PCR and Western Blotting.Results:Compared with the control group,the migration and invasion abilities of PC-9 cells in Intron group significantly decreased(p<0.001).The expression of N-cadherin,β-catenin and snail also down-regulated(p<0.001).Conclusion:The introns could inhibit the EMT of PC-9 cells.展开更多
Inter-reference of competitive reverse transcription polymerase chain reaction (RT-PCR)was constructed by intron method to detect the change of PC mRNA level in the pathway ofcarbohydrate metabolism. The experiment ba...Inter-reference of competitive reverse transcription polymerase chain reaction (RT-PCR)was constructed by intron method to detect the change of PC mRNA level in the pathway ofcarbohydrate metabolism. The experiment based on the principle that 81bp intron sequencewas deleted in PC mRNA compared with PC DNA sequence. The 466bp competitive DNA templaterecombinant plasmid of PC mRNA was successfully built by a pair of primer and was clonedonce, PC DNA and PC mRNA could be inter-referred each other. The intron approach used inthe experiment has broken through the traditional method of constructing competitivetemplate.展开更多
基金supported by a grant from the Double Thousand Plan of Jiangxi Province(No.jxsq2019101057)the National Natural Science Foundation of China(No.3196150349)to Haihui Fu and Xu Jie,respectively.
文摘OsPLS4 encodes aβ-ketoacyl carrier protein reductase(KAR).The role of OsPLS4 in rice sheath blight(Rhizoctonia solani)remains unclear.Our preliminary studies showed that premature leaf senescence mutants(pls4)were highly susceptive to sheath blight in the early stage of rice development.To explore the role of this gene in the development of rice sheath blight,the transcriptome profiles of the rice pls4 mutant and wild type were compared by RNA-seq.The results revealed 2,569 differentially expressed genes(DEGs).The down-regulated genes were significantly enriched in the defense response-related biological processes.These down-regulated genes included the chitinase genes and WRKY genes,which were significantly changed in pls4 mutants.Furthermore,467 genes induced significant alternative splicing(AS)events.Among them,intron retention(IR)affected gene expression levels and functions of the vitamin B6(VB6)metabolism pathway related to sheath blight.This result suggests that IR plays an important role in the sheath blight resistance of mutant pls4.Together,these results indicate that pls4 could be involved in the biological process of sheath blight via DEGs and the fine-tuning of IR.The present study provides a molecular basis for further investigation of the resistance of rice to sheath blight.
文摘There exists a single nucleotide polymorphism, G or T, at the first base of the donor splice site of waxy gene intron 1 in rice. In order to study the relationship between the first base of the donor splice site of waxy gene intron 1 and amylose content in rice, the one-step PCR method was used to determine whether it is G or T in 220 Yunnan indigenous rice varieties from 14 districts, 55 towns/counties of Yunnan Province, and 101 varieties of which were validated by the PCR-Acc I method. According to the G/T polymorphism, 164 rice varieties showed GG-genotype, while the other 56 fell into TT- genotype, accounting for 74.5% and 25.5% of all the test varieties, respectively. When all the rice varieties were divided into indica and japonica subspecies, it was found that 80.5% of indica rice and 67.0% of japonica rice belonged to GG-genotype. The rice varieties with GG-genotype had significantly higher amylose content (18.95% on average) than those with TT- genotype (all below 16%), but 33 rice varieties with GG-genotype still had low amylose content ranging from 3.91% to 15.93%, and most of them came from the Dai minority area in the Southwest of Yunnan Province. However, there was no significant difference in the mean amylose content of the same GG or TT genotypes between indica and japonica rice, suggesting that different genetic backgrounds, indica or japonica, had no effect on amylose content. The coefficient of correlation between the genotype and amylose content was 0.733 (P〈0.01).
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
基金Supported by The Annual Research Fund of the National Research Council of Thailand
文摘AIM:To investigate p53 mutations in esophageal cancer in a high-risk population,and correlate them with smoking,alcohol consumption and betel chewing.METHODS:One hundred and sixty-five tumor samples of esophageal squamous cell carcinoma(ESCC) obtained from a university hospital in Songkhla province,Southern Thailand were investigated for p53 mutations in exons 5-8,using polymerase chain reaction-single strand conformation polymorphism analysis,followed by direct sequencing.A polymerase chain reactionrestriction fragment length polymorphism(RFLP) assay was additionally used to confirm possible germline mutation in intron 6.A history of risk habits was obtained by interviews.The association between risk habits and mutation frequency was evaluated using the χ 2 test.RESULTS:The studied specimens were from 139 male and 26 female patients with ESCC,treated at Songklanagarind Hospital.Most of the patients were smokers(86.7%) and alcohol consumers(72.73%),and 38.3% were betel chewers.Forty-three mutations of the p53 gene were detected in 25.5%(42/165) of tumor samples.Mutations were most commonly found in exon 5(25.6%) and exon 8(25.6%).Mutations in the hot-spot codon 248 were found in four cases(9.3% of all mutations).G:C→C:G(30.23%),G:C→A:T(27.90%) and G:C →T:A(16.28%) were the prevalent spectra of mutations.Unexpectedly,among 10 intronic mutations,eight cases harbored a similar mutation:G→C substitution in intron 6(nucleotide 12759,GenBank NC_000017).These were additionally confirmed by the RFLP technique.Similar mutations were also detected in their matched blood samples using RFLP and direct sequencing,which suggested germline mutations.There was no significant correlation between risk habits and p53 mutation frequency.CONCLUSION:A proportion of Thai ESCC patients harbored specific intronic p53 mutations,which might be germline mutations.Further studies are needed to explore this novel finding.
基金the National Natural Science Foundation of China (30370898,30571187, 30871556)National High Tech Research and Development Program of China (2006AA10Z1D3,2006AA100105)
文摘To develop a new DNA maker, which could be used in genetic diversity analysis and genetic map construction in plants, IT-ISJ (intron targeted intron-exon splice junction) primer combinations, which were designed according to the intronexon splice junction conserved sequences, were used to construct cotton genetic linkage map in the present study. 49 out of 704 IT-ISJ primer combinations showed polymorphism between upland cotton high quality cultivar Yumian 1 and multiple dominant gene line T586, and the polymorphic primer combinations accounted for 7.0% of total primer combinations. 49 IT-ISJ primer combinations were used to genotype 270 F2:7 recombinant inbred lines developed from (Yumian 1 × T586) F2, and 58 IT-ISJ loci were obtained. 58 IT-ISJ, together with 150 SSR and 8 morphological loci, were used to conduct linkage analysis, and a linkage map including 22 linkage groups and 113 loci (49 IT-ISJ, 62 SSR, and 2 morphological loci) was constructed. The linkage map covered 714.5 cM with an average interval of 6.3 cM between two markers, accounting for 16.1% of cotton genome. The present study demonstrated that the polymorphism of IT-ISJ marker is high, and it could be effectively applied in plant genetic map construction.
基金supported by the National Natural Science Fund of China (30970231)the Genetically Modified Organisms Breeding Major Project of China (2014ZX08003001)
文摘supported by the National Natural Science Fund of China (30970231);the Genetically Modified Organisms Breeding Major Project of China (2014ZX08003001)
基金the Indian Council of Agricultural Research,New Delhi,India for research supportpartially funded by the Department of Biotechnology,Government of India,New Delhi,India through a grant support(BT/PR10921/AG11/106/943/2014)
文摘Lentil(Lens culinaris Medik) is one of the most important food legumes in the world. The use in lentil of molecular marker-assisted breeding is limited, owing to the low availability of polymorphic markers. In the present study, we developed a set of polymorphic intron-spanning markers(ISMs) using a cross-species mapping approach. In this approach, putative unique transcripts(PUTs) of L. culinaris were mapped onto the Medicago truncatula genome, exploiting its closeness with the lentil genome. Spliced alignment of the PUTs resulted in a total of 25,717 alignments, allowing the development of 1703 ISMs. From these, a subset of 105 ISMs were synthesized and validated with a 51% amplification success rate in 32 lentil genotypes. Of these ISMs, 40(74%) were polymorphic and generated 2–11 alleles per locus in a genetically diverse panel of 32 lentil genotypes including wild species.This set of polymorphic ISMs along with their functional annotation data will be useful in lentil breeding.
基金Supported by Eleventh Five-Year Development Planning For Instructional Science in Hubei Province(2006B131)
文摘In this study,three weight vectors L1,L2 and L3 were set.After calculating the probability of three bases in the exons or introns in the genomic DNA of Arabidopsis thaliana,64-dimensional vector P was obtained.Dot products of P vector and three weight vectors were the feature coordinates for the exons and introns in 3-dimensional phase space.The expression for the interface between the exons and the introns in the genomic DNA of Arabidopsis thaliana in 3-dimensional phase space was established,which could be used to distinguish the exons and the introns in the genomic DNA of Arabidopsis thaliana with an accuracy higher than85%in 3-dimensional phase space.
基金Supported by the National Natural Science Foundation of China under Grants Nos.61804184 and 11975311the Natural Science Basic Research Plan in Shaanxi Province of China under Grant No.2020JQ470the Foundation of Independent Scientific Research under Grant Nos.YNJC19070501,YNJC19070502,and YNJC19070504。
文摘A spintronics neuron device based on voltage-induced strain is proposed.The stochastic switching behavior,which can mimic the firing behavior of neurons,is obtained by using two voltage signals to control the in-plane magnetization of a free layer of magneto-tunneling junction.One voltage signal is used as the input,and the other voltage signal can be used to tune the activation function(Sigmoid-like) of spin neurons.Therefore,this voltage-driven tunable spin neuron does not necessarily use energy-inefficient Oersted fields and spin-polarized current.Moreover,a voltage-control reading operation is presented,which can achieve the transition of activation function from Sigmoid-like to Re LU-like.A three-layer artificial neural network based on the voltage-driven spin neurons is constructed to recognize the handwritten digits from the MNIST dataset.For the MNIST handwritten dataset,the design achieves 97.75% recognition accuracy.The present results indicate that the voltage-driven adaptive spintronic neuron has the potential to realize energy-efficient well-adapted neuromorphic computing.
文摘Although a great deal of research has been undertaken in the area of the annotation of gene structure, predictive techniques are still not fully developed. In this paper, based on the characteristics of base composition of sequences and conservative of nucleotides at exon/intron splicing site, a least increment of diversity al-gorithm (LIDA) is developed for studying and predicting three kinds of coding exons, introns and intergenic regions. At first, by selecting the 64 trinucleotides composition and 120 position parameters of the four bases as informational parameters, coding exon, intron and intergenic sequence are predicted. The results show that overall predicted accuracies are 91.1% and 88.4%, respectively for A. thaliana and C. ele-gans genome. Subsequently, based on the po-sition frequencies of four kinds of bases in regions near intron/coding exon boundary, initia-tion and termination site of translation, 12 position parameters are selected as diversity source. And three kinds of the coding exons are predicted by use of the LIDA. The predicted successful rates are higher than 80%. These results can be used in sequence annotation.
文摘Pigmentation plays important adaptation and physiological efficiency roles in animals. In the sequence of a 648 bp fragment representing intron 1, exon 2, and part of intron 2 of the MLPH mammalian pigmentation gene, we identified a novel g.469C> G mutation in intron 2, and genotyped it in 266 Nigerian goats using PCR-RFLP analysis. The C allele had frequencies of 0.9625, 0.9804 and 0.97405 in West African Dwarf (WAD),Sahel(SH) and Red Sokoto (RS) breeds, respectively. The G allele was the highest in WAD (0.0375), followed by RS (0.02595), and then SH (0.0196). Overall low FIS and FST and high Nm values demonstrate little differentiation within and among the goat breeds at this intronic locus. This g.469C> G polymorphism in MLPH gene is the first in any goat breed and also first in Nigerian goats. Our results suggest that this intronic SNP locus is maintained at Hardy-Weinberg equilibrium (P < 0.05) and the lack of association of this SNP with coat color may indicate its neutrality in goats.
文摘One of the features of intron-containing genes of the nxf (nuclear export factor) family in different organisms is the presence of an evolutionarily conserved exon-intron block: exon 110nt-intron-exon 37nt. The intron in this evolutionarily conserved block, which we call a “cassette” intron, can be excised or retained in alternative transcripts of nxf1. It corresponds to intron 10 -11 inthe genes that are orthologous to nxf1 in vertebrates, and intron 5 -6 inthe genes that are orthologous to nxf1 in Drosophilidae. The alignment of sequences of cassette introns in nxf1 genes in vertebrates has revealed four evolutionarily conserved sequences: 1)5’flanking sequence, 2) a region containing СТЕ (constitutive transport element), 3) third conserved sequence, and 4)3’flanking sequence. Introns 5-6 of nxf1 in Drosophilidae have no similar conserved sequences. The results of sequence alignment demonstrate a similarity between cassette introns of nxf1 in Drosophilidae in two poly(A) sequences. The prevalence of Dm nxf1 transcripts containing cassette intron 5-6 under completely spliced transcripts in the heads of adult Drosophila melanogaster suggests a functional importance of transcripts that contain a retained intron. Evolutionary conservation, which in Drosophilidae is evident in the presence of poly(A) sequences in cassette introns of the nxf1 genes, is an adaptive feature: the poly(A) sequences are capable of mimicking the 3’-end of transcripts, promote transport from the nucleus to the cytoplasm, or are involved in NMD control. The ability to form characteristic secondary structures is a common feature of nxf1 cassette introns.
基金funded by the Research Project of Hebei United University ( 07101168)
文摘[ Objective] The aim of this paper is to provide the basic data for marker-assisted selection of pig breeding using porcine heart fatty acid- binding protein (H-FABP) gene. [Method] According to the related sequences of porcine H-FABP gene released in GenBank, specific primers were designed to amplify the intron 3 of porcine H-FABP gene. [ Result] The intron 3 of porcine H-FABP gene was amplified successfully. Its whole sequence was 1 350 bp in length and had been submitted to GenBank (Accession no. : DQ 002993). [Condusion] The study lays a theoretical foundation for determination of the major genes affecting intramuscular fat deposition.
基金National Natural Science Foundation of China(No.81660474)。
文摘Objective:To investigate the effects of Intron on the EMT capability of non-small cell lung cancer cell line PC-9.Methods:Firstly,using the psiCHECK-2 plasmid as a basic framework to construct the recombinant plasmid of psiCHECK-2-Intron dual-luciferase reporter gene;secondly,the psiCHECK-2-Intron and psiCHECK-2 were transfected into PC-9 cells respectively.The migration and invasion abilities of PC-9 cells were analyzed by Matrigel assay.The expression changes of EMT related hallmarks,including N-cadherin,β-catenin and snail,were detected by qRT-PCR and Western Blotting.Results:Compared with the control group,the migration and invasion abilities of PC-9 cells in Intron group significantly decreased(p<0.001).The expression of N-cadherin,β-catenin and snail also down-regulated(p<0.001).Conclusion:The introns could inhibit the EMT of PC-9 cells.
基金supported by the National Natural Science Foundation of China(30230620).
文摘Inter-reference of competitive reverse transcription polymerase chain reaction (RT-PCR)was constructed by intron method to detect the change of PC mRNA level in the pathway ofcarbohydrate metabolism. The experiment based on the principle that 81bp intron sequencewas deleted in PC mRNA compared with PC DNA sequence. The 466bp competitive DNA templaterecombinant plasmid of PC mRNA was successfully built by a pair of primer and was clonedonce, PC DNA and PC mRNA could be inter-referred each other. The intron approach used inthe experiment has broken through the traditional method of constructing competitivetemplate.