In silico Prediction and Analysis of Potential Off-Targets and Off-Target Mutation Detection in StERF3-Gene Edited Potato Plants

The imperative aspect of the CRISPR/Cas9 system is a short stretch of 20 nucleotides of gRNA that control the overall specificity.Due to the small size,the chance of its multiple occurrences in the genome increases;however,a few mismatches are tolerated by the Cas9 endonuclease activity.An accurate and careful in silico-based off-target prediction while target selection is preferred to address the issue.These predictions are based on a comprehensive set of selectable parameters.Therefore,we investigated the possible off-target prediction and their screening in StERF3 gene-edited potato plants while developing StERF3-loss-of-function mutants using CRISPR/Cas9 approach.The 201 off-targets for the selected targets of the StERF3 gene were predicted,and 79 werefiltered as potential off-targets.Of these 79,twenty-five off-targets showed scores with defined cut-off values<0.5 and were analyzed in Sterf3-edited potato plants compared to wild-type plants.No off-targeting was found to have occurred in edited plants.

Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines

The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.

A survey on the off-target effects of insecticidal double-stranded RNA targeting the Hvβ'COPI gene in the crop pest Henosepilachna vigintioctopunctata through RNA-seq

The specificity of the double-stranded RNA(dsRNA) used in the RNA interference(RNAi) technique is crucial for the success of sequence-specific gene silencing. Currently, RNAi-mediated insect control is a trending research topic.However, the off-target effects of the dsRNA in RNAi are a major concern. In this study, the ds Hvβ’COPI(coat protein complex I, β’ subunit)-treated and untreated transcriptomes of the 28-spotted potato lady beetle(Henosepilachna vigintioctopunctata) were compared to understand its off-target gene silencing effects. The RNA-seq results revealed that 63 and 44 differentially expressed genes(DEGs) were upregulated and downregulated, respectively, in the ds Hvβ’COPI treated group as compared with the control. Validation of the differential expressions of some selected DEGs via reverse transcription-quantitative PCR(RT-qPCR) analysis confirmed the reliability of the transcriptome analysis results. Further downstream analysis revealed that there were no genes homologous with Hvβ’COPI in H. vigintioctopunctata. Additionally,no genes with a >11 bp continuous match with ds Hvβ’COPI were found in the H. vigintioctopunctata transcriptome. Six genes(Hvcitron, Hvhelicase, Hvtransposase, Hvserine, Hvdynein, and Hv E3 ubiquitin) were selected to examine the offtarget activity of ds Hvβ’COPI based on their potential involvement in various H. vigintioctopunctata metabolic pathways.The severity of silencing these six off-target genes was evaluated by employing RNAi. The RNAi results confirmed the downregulation of the expression of all six genes, although there was no significant lethality. The findings of this study will be helpful in the risk analysis of future RNAi-mediated pest control experiments.

Using transcriptome Shannon entropy to evaluate the off-target effects and safety of insecticidal siRNAs

A recent breakthrough in agricultural biotechnology is the introduction of RNAi-mediated strategies in pest control.However, the off-target effects of RNAi pest control are still not fully understood. Here, we studied the off-target effects of two insecticidal siRNAs in both target and non-target insects. The results revealed that off-target effects of insecticidal siRNAs occur widely in both target and non-target insects. We classified the expression-changed genes according to their homology to the siRNA-targeted gene, related KEGG pathways with the siRNA-targeted gene and continuous matches with siRNAs. Surprisingly, the unintended significant changes in gene expression levels did not strictly match with the number of contiguous nucleotides in the siRNAs. As expected, the expression of small portions of the homologous and KEGG-related genes were significantly changed. We calculated the Shannon entropy of the transcriptome profile of the insects after injecting them with insecticidal siRNAs. Though hundreds of genes were affected in their expression levels post siRNAtreatment, the Shannon entropy of the transcriptome remained unchanged, suggesting that the transcriptome expression was balanced. Our results provide evidence that siRNAs cross-reacted with individual genes in non-target species, but did not have significant effects on the integrity of the transcriptome profiles in either target or non-target species on a genomic scale. The metric we proposed can be used to estimate the off-target effects of insecticidal siRNAs, which might be useful for evaluating the safety of RNAi in pest control.

In silico off-target profiling for enhanced drug safety assessment

Ensuring drug safety in the early stages of drug development is crucial to avoid costly failures in subsequent phases.However,the economic burden associated with detecting drug off-targets and potential side effects through in vitro safety screening and animal testing is substantial.Drug off-target interactions,along with the adverse drug reactions they induce,are significant factors affecting drug safety.To assess the liability of candidate drugs,we developed an artificial intelligence model for the precise prediction of compound off-target interactions,leveraging multi-task graph neural networks.The outcomes of off-target predictions can serve as representations for compounds,enabling the differentiation of drugs under various ATC codes and the classification of compound toxicity.Furthermore,the predicted off-target profiles are employed in adverse drug reaction(ADR)enrichment analysis,facilitating the inference of potential ADRs for a drug.Using the withdrawn drug Pergolide as an example,we elucidate the mechanisms underlying ADRs at the target level,contributing to the exploration of the potential clinical relevance of newly predicted off-target interactions.Overall,our work facilitates the early assessment of compound safety/toxicity based on off-target identification,deduces potential ADRs of drugs,and ultimately promotes the secure development of drugs.

CRISPR/Cas9: Development and Application in Rice Breeding

Rice(Oryza sativa L.)is an important staple food crop worldwide due to its adaptability to different environmental conditions.Because of its great economic and social importance,there is a constant requirement for new varieties with improved agronomic characteristics,such as tolerance to different biotic(such as bacterium,fungus,insect and virus)and abiotic stresses(such as salinity,drought and temperature),higher yield and better organoleptic and nutritional value.Among the new genome editing technologies,the clustered regularly interspaced short palindromic repeats(CRISPR)/CRISPR-associated protein(Cas)(CRISPR/Cas)system allows precise and specific edition in a targeted genome region.It is one of the most frequently used techniques for the study of the function of new genes and for the development of mutant lines with enhanced tolerance to biotic and abiotic stresses,herbicide resistance or improved yield.The wide varieties of applications for this technology include simple non-homologous end joining,homologous recombination,gene replacement,and base editing.In this review,we analyzed how some of these applications have been used in rice cultivars to obtain rice varieties better adapted to current environmental conditions and market requirements.

Highly efficient generation of GGTA1 knockout pigs using a combination of TALEN m RNA and magnetic beads with somatic cell nuclear transfer

The transcription activator-like effector nuclease （TALEN） technique combined with the somatic cel nuclear transfer （SCNT） method has been successfuly applied for creating geneticaly modiifed pigs. However, methods for isolating cels with bialelic indels requires further improvement because of the relatively low enrichment efifciency of mutated somatic cels. Moreover, little is known regarding the off-target effects of the TALEN system and the heredity of TALEN-modiifed pigs. In this study, an efifcient method to increase the enrichment efifciency of TALEN-mediated bialelic knockout （KO） cels was established, and corresponding geneticaly modiifed pigs with the expected genotype were generated whose off-target effect, fertility and heredity characteristics were aslo evaluated. Two TALEN pairs were constructed to target the porcine α-1,3-galactosyltransferase （GGTA1） gene locus. TALEN mRNA was transfected into the ear ifbroblasts folowed by the enrichment of α-Gal nul cels of minipigs using isolectin B4 （IB4） lectin and magnetic beads. A total of 115 cel colonies were formed and validated to beGGTA1 KO cels by sequencing and 10 bialelic KO cel colonies were used as nuclear donors for SCNT. ThirtyGGTA1 bialelic KO piglets were successfuly delivered and grew normaly. Seventeen potential off-target sites were investigated, and no off-target events were detected in the live piglets. To determine the fertility and heredity characteristics of TALEN-modiifed pigs, 10 mature founders were mated with each other and the mutations were determined to be transmitted to the F1 piglets. We established a robust and safe technology for developing geneticaly modiifed pig lines with expected genotypes for agricultural breeding and biomedical application.

CRISPR/Cas9 from bench to bedside:What clinicians need to know before application?

In October 2020,Dr.Emmanuelle Charpentier and Dr.Jennifer Doudna won the Nobel Prize in Chemistry for their pioneering work in precise genome editing using the CRISPR technology.Although CRISPR technology has developed rapidly in the last decade,there are still many uncertainties before eventual use in clinical settings.In this mini review,we summarize the current efforts in addressing the limitations of CRISPR technology and future directions.

Risks of CRISPR Gene Editing and An Answer to Them

CRISPR gene editing is a technology used to edit genomes of a variety of organisms like bacteria,animals or even human beings.Curently,there are various criticism concerning CRISPR since the technology is still immature.It's important to address these concerns to ensure that CRISPR wouldm't cause harms to the society.The pupose of this investigation is to summarize methods which can be used to solve the risks and ethical issues regarding CRISPR through examining published researches in-depth To draw a conclusion,scientists can use anti-crispr protein to minimize the off-target effects.For immunity issues,scientists can employ immunosuppressive drugs or to use CRISPR in places where immune system cannot reach.What's more,given both legaland ethical hurdles,the problem of designer babies and bio-weapons are unlikely to happen.Therefore,although there are various concerns regarding CRISPR,scientists are figuring out ways to minimize the risks and to optimize the usage of the CRISPR.

Review: Plant Genome Editing Targeted by RNA-Guided DNA Endonuclease CRISPR/Cas9

This review chronicles the development of the research on CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeat/CRISPR associated protein 9) during the last 30 years from the discovery of CRISPR sequence, of biological significance and of the molecular mechanism for adaptive bacterial immunity. It describes recent works on structural and functional diversity of CRISPR/Cas systems, and on three-dimensional structure-based improvements of on-target specificity of CRISPR/Cas9 and Cpf1 endonucleases. The review ends with the application of CRISPR/Cas9 to targeted editing of plant genomes. Importantly, plant commodities modified by CRISPR-Cas9 have not been considered as genetically modified organisms (GMO) as long as foreign DNAs from plant pests were not introduced, according to the recent determination by the USDA.

Transcription-wide impact by RESCUE-induced off-target single-nucleotide variants in mammalian cells

RNA base editing is a promising tool in precise molecular therapy. Currently, there are two widely used RNA base editors, REPAIRand RESCUE. REPAIR only facilitates A-to-I conversions, while RESCUE performs both A-to-I and C-to-U conversions. Thus, RESCUEcan generate twice the number of mutations compared to REPAIR. However, transcription-wide impact due to RESCUE-induced offtarget single-nucleotide variants (SNVs) is not fully appreciated. Therefore, to determine the off-target effects of RESCUE-mediatedediting, we employed transcription-wide sequencing on cells edited by RESCUE. The SNVs showed different off-target effects onmRNA, circRNA, lncRNA, and miRNA expression patterns and their interacting networks. Our results illustrate the transcriptionwide impact of RESCUE-induced off-target SNVs and highlight the need for careful characterization of the off-target impact by thisediting platform.

RNA interference in insects:the link between antiviral defense and pest control

RNA interference(RNAi)is a form of gene silencing triggered by double-stranded RNA(dsRNA)that operates in all eukaryotic cells.RNAi has been widely investigated in insects to determine the underlying molecular mechanism,to investigate its role in systemic antiviral defense,and to develop strategies for pest control.When insect cells are infected by viruses,viral dsRNA signatures trigger a local RNAi response to block viral replication and generate virus-derived DNA that confers systemic immunity.RNAi-based insect pest control involves the application of exogenous dsRNA targeting genes essential for insect development or survival,but the efficacy of this approach has limited potency in many pests through a combination of rapid dsRNA degradation,inefficient dsRNA uptake/processing,and ineffective RNAi machinery.This could be addressed by dsRNA screening and evaluation,focusing on dsRNA design and off-target management,as well as dsRNA production and delivery.This review summarizes recent progress to determine the role of RNAi in antiviral defense and as a pest control strategy in insects,addressing gaps between our fundamental understanding of the RNAi mechanism and the exploitation of RNAi-based pest control strategies.

Advances in detecting and reducing off-target effects generated by CRISPR-mediated genome editing

CRISPR-mediated genome editing is a revolutionary technology for genome manipulation that uses the CRISPR-Cas systems and base editors.Currently,poor efficiency and off-target problems have impeded the application of CRISPR systems.The on-target efficiency has been improved in several advanced versions of CRISPR systems,whereas the off-target detection still remains a key challenge.Here,we outline the different versions of CRISPR systems and off-target detection strategies,discuss the merits and limitations of off-target detection methods,and provide potential implications for further gene editing research.

Engineering guide RNA to reduce the off-target effects of CRISPR

As versatile and robust genome editing tools,clustered regularly interspaced short palindromic repeats(CRISPR)technologies have been broadly used in basic research,biotechnology,and therapeutic development.Off-target mutagenesis by CRISPR systems has been demonstrated,and various methods have been developed to markedly increase their specificity.In this review,we highlight the efforts of producing and modifying guide RNA(gRNA)to minimize off-target activities,including sequence and structure design,tuning expression and chemical modification.The modalities of gRNA engineering can be applied across CRISPR systems.In conjunction with CRISPR protein effectors,the engineered gRNA enables efficient and precise genome editing.

Efficient Gene Targeting in Zebrafish Mediated by a Zebrafish-Codon-Optimized Cas9 and Evaluation of Off-Targeting Effect

Targeted genome modifications with the Cas9/gRNA system derived from the clustered regularly interspaced short palin- dromic repeat/CRISPR-associated （CRISPR/Cas） system have been successfully used in cultured human cells as well as in most model organisms, including zebrafish （Danio rerio）, mouse, and fruit fly （Chang et al., 2013; Cong et al., 2013; Gratz et al., 2013; Hwang et al., 2013; Jao et al., 2013; Shen et al., 2013; Wei et al., 2013）. Its application in zebrafish is particu- larly attractive due to the ease of handling this organism and the simple application of this method by direct injection of Cas9/ gRNA. However, the information about its specificity in this organism is very limited and needs further evaluation. In addition, it is conceivable that a Cas9 mRNA optimized for zebrafish codon preference could enhance its activity.

Off-target effects of cytidine base editor and adenine base editor:What can we do?

DNA is the blueprint of life,instructing the growth,development,and reproduction of an organism.Genome sequencing uncovers the codes of life,whereas genome editing could rewrite the codes,thus then leads to revolutionary advances in all aspects of life sciences,such as uncovering regulatory network of life,increasing the production of crops,producing new breeds of livestock,and curing genetic disorders(Liu,2017).

An Integrated Workflow for Proteome-Wide Off-Target Identification and Polypharmacology Drug Design

Polypharmacology,which focuses on designing drugs to target multiple receptors,has emerged as a new paradigm in drug discovery.To rationally design multi-target drugs,it is fundamental to understand protein-ligand interactions on a proteome scale.We have developed a Proteome-wide Off-target Pipeline （POP） that integrates ligand binding site analysis,protein-ligand docking,the statistical analysis of docking scores,and electrostatic potential calculations.The utility of POP is demonstrated by a case study,in which the molecular mechanism of anti-cancer effect of Nelfinavir is hypothesized.By combining structural proteome-wide off-target identification and systems biology,it is possible for us to correlate drug perturbations with clinical outcomes.

Site-directed RNA editing(SDRE):Off-target effects and their countermeasures

Site-directed RNA editing(SDRE)is invaluable to basic research and clinical applications and has emerged as a new frontier in genome editing.The past few years have witnessed a surge of interest in SDRE,with SDRE tools emerging at a breathtaking pace.However,off-target effects of SDRE remain a tough problem,which constitutes a major hurdle to their clinical applications.Here we discuss the diverse strategies for combating off-target editing,drawing lessons from the published studies as well as our ongoing research.Overall,SDRE is still at its infancy,with significant challenges and exciting opportunities ahead.

Superior Fidelity and Distinct Editing Outcomes of SaCas9 Compared with SpCas9 in Genome Editing

A series of clustered regularly interspaced short palindromic repeats(CRISPR)-CRISPR associated protein 9(Cas9)systems have been engineered for genome editing.The most widely used Cas9 is SpCas9 from Streptococcus pyogenes and SaCas9 from Staphylococcus aureus.However,a comparison of their detailed gene editing outcomes is still lacking.By characterizing the editing outcomes of 11 sites in human induced pluripotent stem cells(iPSCs)and K562 cells,we found that SaCas9 could edit the genome with greater efficiencies than SpCas9.We also compared the effects of spacer lengths of single-guide RNAs(sgRNAs;18–21 nt for SpCas9 and 19–23 nt for SaCas9)and found that the optimal spacer lengths were 20 nt and 21 nt for SpCas9 and SaCas9,respectively.However,the optimal spacer length for a particular sgRNA was 18–21 nt for SpCas9 and 21–22 nt for SaCas9.Furthermore,SpCas9 exhibited a more substantial bias than SaCas9 for nonhomologous end-joining(NHEJ)+1 insertion at the fourth nucleotide upstream of the protospacer adjacent motif(PAM),indicating a characteristic of a staggered cut.Accordingly,editing with SaCas9 led to higher efficiencies of NHEJ-mediated double-stranded oligodeoxynucleotide(dsODN)insertion or homology-directed repair(HDR)-mediated adeno-associated virus serotype 6(AAV6)donor knock-in.Finally,GUIDE-seq analysis revealed that SaCas9 exhibited significantly reduced off-target effects compared with SpCas9.Our work indicates the superior performance of SaCas9 to SpCas9 in transgene integration-based therapeutic gene editing and the necessity to identify the optimal spacer length to achieve desired editing results.

Genome editing in cancer:Challenges and potential opportunities

Ever since its mechanism was discovered back in 2012,the CRISPR/Cas9 system have revolutionized the field of genome editing.While at first it was seen as a therapeutic tool mostly relevant for curing genetic diseases,it has been recently shown to also hold the potential to become a clinically relevant therapy for cancer.However,there are multiple challenges that must be addressed prior to clinical testing.Predominantly,the safety of the system when used for in-vivo therapies,including off-target activity and the effects of the double strand break induction on genomic stability.Here,we will focus on the inherent challenges in the CRISPR/Cas9 system and discuss various opportunities to overcoming these challenges.