The transcription factor SlHY5 regulates the ripening of tomato fruit at both the transcriptional and translational levels

Light plays a critical role in plant growth and development,but the mechanisms through which light regulates fruit ripening and nutritional quality in horticultural crops remain largely unknown.Here,we found that ELONGATED HYPOCOTYL 5(HY5),a master regulator in the light signaling pathway,is required for normal fruit ripening in tomato(Solanum lycopersicum).Loss of function of tomato HY5(SlHY5)impairs pigment accumulation and ethylene biosynthesis.Transcriptome profiling identified 2948 differentially expressed genes,which included 1424 downregulated and 1524 upregulated genes,in the Slhy5 mutants.In addition,genes involved in carotenoid and anthocyanin biosynthesis and ethylene signaling were revealed as direct targets of SlHY5 by chromatin immunoprecipitation.Surprisingly,the expression of a large proportion of genes encoding ribosomal proteins was downregulated in the Slhy5 mutants,and this downregulation pattern was accompanied by a decrease in the abundance of ribosomal proteins.Further analysis demonstrated that SlHY5 affected the translation efficiency of numerous ripening-related genes.These data indicate that SlHY5 regulates fruit ripening both at the transcriptional level by targeting specific molecular pathways and at the translational level by affecting the protein translation machinery.Our findings unravel the regulatory mechanisms of SlHY5 in controlling fruit ripening and nutritional quality and uncover the multifaceted regulation of gene expression by transcription factors.

Gene Mutation Screening by Using Coupled In Vitro Transcription and Translation System

A new method for screening gene mutations by using a Coupled In Vitro Transcription and Translation System is reported in this paper. It includes the following steps: (1) The target DNA fragments with T7T1 sequence at its 5 prime end are amplified (T7T1: GGATCCTAATACGACTCTATAGGGAG ACCACCATG); (2) The RNA and peptide are synthesized and labeled from the PCR product in the coupled In Vitro Transcription-Translation System; (3) The produced peptides are analyzed by using SDS-PAGE and pH Gradient gel focusing electrophoresis. Four peptide products from 4 HB patients with nonsense mutation in Exon H of F IX gene show truncated protein bands with speeded migration in the autoradiography of the SDS-PAGE. Ten out of 11 HB patients with different missense mutations show abnormal patterns in the autoradiography of a pH 4-7 gradient gel focusing electrophoresis. Conclusion: The PCR and the Coupled In Vitro Transcription-Translation System/SDS-PAGE is a good method for proteins truncation test. The PCR and the Transcription-Translation System combined with pH gradient gel focusing electrophoresis is an efficient method for screening the abnormal protein products from DNA fragments with missense mutations.

The BEL1-like transcription factor GhBLH5-A05 participates in cotton response to drought stress

Drought stress impairs crop growth and development.BEL1-like family transcription factors may be involved in plant response to drought stress,but little is known of the molecular mechanism by which these proteins regulate plant response and defense to drought stress.Here we show that the BEL1-like transcription factor GhBLH5-A05 functions in cotton(Gossypium hirsutum)response and defense to drought stress.Expression of GhBLH5-A05 in cotton was induced by drought stress.Overexpression of GhBLH5-A05 in both Arabidopsis and cotton increased drought tolerance,whereas silencing GhBLH5-A05 in cotton resulted in elevated sensitivity to drought stress.GhBLH5-A05 binds to cis elements in the promoters of GhRD20-A09 and GhDREB2C-D05 to activate the expression of these genes.GhBLH5-A05 interacted with the KNOX transcription factor GhKNAT6-A03.Co-expression of GhBLH5-A05 and GhKNAT6-A03 increased the transcription of GhRD20-A09 and GhDREB2C-D05.We conclude that GhBLH5-A05 acts as a regulatory factor with GhKNAT6-A03 functioning in cotton response to drought stress by activating the expression of the drought-responsive genes GhRD20-A09 and GhDREB2C-D05.

A Descriptive Translation Study of Chinese Translation of French Musical Roméo et Juliette

This paper presents a Descriptive Translation Study(DTS)analysis of the Chinese translation of the French musical adaptation of Romeo and Juliet,titled Roméo et Juliette:de la Haineàl’Amour.Romeo and Juliet,a timeless play by Shakespeare,has captivated audiences since its premiere in 1597 and has been adapted into various forms,including stage productions,films,musicals,and operas.The focus of this study is to analyze the Chinese translation of the French musical adaptation from a DTS perspective.DTS is an approach that aims to understand the translation process and its reception in the target culture.By examining language choices,cultural references,and adaptation strategies,this study seeks to shed light on how the Chinese translation of the French musical functions within the target culture and influences the reception and interpretation of the source text.This analysis is expected to gain insights into the challenges and strategies employed in translating a musical adaptation of Romeo and Juliet into Chinese.The findings of this study will contribute to the field of translation studies and provide a deeper understanding of the complexities involved in the translation of musical works.

Cultivation of Translators for Multimodal Translation in the New Media Age

In the 21st century,the development of digital and new media technologies has ushered in an age of pervasive multimodal communication,which has significantly amplified the role of multimodal translation in facilitating crosscultural exchanges.Despite the profound impact of these developments,the prevailing translation pedagogy remains predominantly focused on the enhancement of linguistic translation skills,with noticeable neglect of the imperative to cultivate students’competencies in multimodal translation.Based on the distinctive characteristics and challenges that multimodal translation presents in the context of new media,this study delves into the formulation of educational objectives and curriculum design for the training of multimodal translators.The intent is to propose a framework that can guide the preparation of translators who are adept and equipped to navigate the complexities and demands of the contemporary age.

Transcription factor OsSPL10 interacts with OsJAmyb to regulate blast resistance in rice

Transcription factors(TFs)play essential roles in transcriptional reprogramming during activation of plant immune responses to pathogens.OsSPL10(SQUAMOSA promoter binding protein-like10)is an important TF regulating trichome development and salt tolerance in rice.Here we report that knockout of OsSPL10 reduces whereas its overexpression enhances rice resistance to blast disease.OsSPL10 positively regulates chitin-induced immune responses including reactive oxygen species(ROS)burst and callose deposition.We show that OsSPL10 physically associates with OsJAmyb,an important TF involved in jasmonic acid(JA)signaling,and positively regulates its protein stability.We then prove that OsJAmyb positively regulates resistance to blast.Our results reveal a molecular module consisting of OsSPL10 and OsJAmyb that positively regulates blast resistance.

Phase separation and transcriptional regulation in cancer development

Liquid-liquid phase separation,a novel biochemical phenomenon,has been increasingly studied for its medical applications.It underlies the formation of membrane-less organelles and is involved in many cellular and biological processes.During transcriptional regulation,dynamic condensates are formed through interactions between transcriptional elements,such as transcription factors,coactivators,and mediators.Cancer is a disease characterized by uncontrolled cell proliferation,but the precise mechanisms underlying tumorigenesis often remain to be elucidated.Emerging evidence has linked abnormal transcriptional condensates to several diseases,especially cancer,implying that phase separation plays an important role in tumorigenesis.Condensates formed by phase separation may have an effect on gene transcription in tumors.In the present review,we focus on the correlation between phase separation and transcriptional regulation,as well as how this phenomenon contributes to cancer development.

Transcriptional regulation in the development and dysfunction of neocortical projection neurons

Glutamatergic projection neurons generate sophisticated excitatory circuits to integrate and transmit information among different cortical areas,and between the neocortex and other regions of the brain and spinal cord.Appropriate development of cortical projection neurons is regulated by certain essential events such as neural fate determination,proliferation,specification,differentiation,migration,survival,axonogenesis,and synaptogenesis.These processes are precisely regulated in a tempo-spatial manner by intrinsic factors,extrinsic signals,and neural activities.The generation of correct subtypes and precise connections of projection neurons is imperative not only to support the basic cortical functions(such as sensory information integration,motor coordination,and cognition)but also to prevent the onset and progression of neurodevelopmental disorders(such as intellectual disability,autism spectrum disorders,anxiety,and depression).This review mainly focuses on the recent progress of transcriptional regulations on the development and diversity of neocortical projection neurons and the clinical relevance of the failure of transcriptional modulations.

Wild soybean(Glycine soja)transcription factor GsWRKY40 plays positive roles in plant salt tolerance

Wild soybean(Glycine soja),a relative of cultivated soybean,shows high adaptability to adverse environmental conditions.We identified and characterized a wild soybean transcription factor gene,GsWRKY40,that promotes plant salt stress.GsWRKY40 was highly expressed in wild soybean roots and was up-regulated by salt treatment.GsWRKY40 was localized in nucleus and demonstrated DNA-binding activities but without transcriptional activation.Mutation and overexpression of GsWRKY40 altered salt tolerance of Arabidopsis plants.To understand the molecular mechanism of GsWRKY40 in regulating plant salt resistance,we screened a cDNA library and identified a GsWRKY40 interacting protein GsbHLH92 by using yeast two-hybrid approach.The physical interaction of GsWRKY40 and GsbHLH92 was confirmed by co-immunoprecipitation(co-IP),GST pull-down,and bimolecular fluorescence complementation(BiFC)techniques.Intriguingly,co-overexpression of GsWRKY40 and GsbHLH92 resulted in higher salt tolerance and lower ROS levels than overexpression of GsWRKY40 or GsbHLH92 in composite soybean plants,suggesting that GsWRKY40 and GsbHLH92 may synergistically regulate plant salt resistance through inhibiting ROS production.qRT-PCR data indicated that the expression level of GmSPOD1 gene encoding peroxidase was cooperatively regulated by GsWRKY40 and GsbHLH92,which was confirmed by using a dual luciferase report system and yeast one-hybrid experiment.Our study reveals a pathway that GsWRKY40 and GsbHLH92 collaboratively up-regulate plant salt resistance through impeding GmSPOD1 expression and reducing ROS levels,providing a novel perspective on the regulatory mechanisms underlying plant tolerance to abiotic stresses.

Meiotic transcriptional reprogramming mediated by cell-cell communications in humans and mice revealed by scATACseq and scRNA-seq

Meiosis is a highly complex process significantly influenced by transcriptional regulation.However,studies on the mechanisms that govern transcriptomic changes during meiosis,especially in prophase I,are limited.Here,we performed single-cell ATAC-seq of human testis tissues and observed reprogramming during the transition from zygotene to pachytene spermatocytes.This event,conserved in mice,involved the deactivation of genes associated with meiosis after reprogramming and the activation of those related to spermatogenesis before their functional onset.Furthermore,we identified 282 transcriptional regulators(TRs)that underwent activation or deactivation subsequent to this process.Evidence suggested that physical contact signals from Sertoli cells may regulate these TRs in spermatocytes,while secreted ENHO signals may alter metabolic patterns in these cells.Our results further indicated that defective transcriptional reprogramming may be associated with non-obstructive azoospermia(NOA).This study revealed the importance of both physical contact and secreted signals between Sertoli cells and germ cells in meiotic progression.

Sugarcane transcription factor ScWRKY4 negatively regulates resistance to pathogen infection through the JA signaling pathway

WRKY transcription factors,transcriptional regulators unique to plants,play an important role in defense response to pathogen infection.However,the resistance mechanisms of WRKY genes in sugarcane remain unclear.In the present study,gene ontology(GO)enrichment analysis revealed that WRKY gene family in sugarcane was extensively involved in the response to biotic stress and in defense response.We identified gene ScWRKY4,a classⅡc member of the WRKY gene family,in sugarcane cultivar ROC22.This gene was induced by salicylic acid(SA)and methyl jasmonate(MeJA)stress.Interestingly,expression of ScWRKY4 was down-regulated in smut-resistant sugarcane cultivars but up-regulated in smutsusceptible sugarcane cultivars infected with Sporisorium scitamineum.Moreover,stable overexpression of the ScWRKY4 gene in Nicotiana benthamiana enhanced susceptibility to Fusarium solani var.coeruleum and caused down-regulated expression of immune marker-related genes.Transcriptome analysis indicated suppressed expression of most JAZ genes in the signal transduction pathway.ScWRKY4 interacted with ScJAZ13 to repress its expression.We thus hypothesized that the ScWRKY4 gene was involved in the regulatory network of plant disease resistance,most likely through the JA signaling pathway.The present study depicting the molecular involvement of ScWRKY4 in sugarcane disease resistance lays a foundation for future investigation.

Cu Stress-Induced Transcriptome Alterations in Sorghum and Expression Analysis of the Transcription Factor-Encoding Gene SbWRKY24

Sorghum is not only an important bio-energy crop but also a vital raw material for brewing.Exogenous copper affects the growth and metabolism of crops in specific ways.This study identified 8475 differentially expressed genes(DEGs)by high-throughput transcriptome sequencing in the sorghum cultivar‘Jinnuoliang 2’after 24 h of treatment with 10 mM CuSO4.Using GO analysis,476 genes were functionally annotated,which were mainly related to catabolism and biosynthetic processes.Additionally,90 pathways were annotated by employing the KEGG analysis.Among them,glutathione metabolism and peroxisome were induced,while photosynthesis,photosynthesis-antenna protein,and carbon sequestration of photosynthetic organisms were inhibited.Of the DEGs,399 were identified to encode transcription factors belonging to 49 families.This study also identified a WRKY transcription factor-encoding gene SbWRKY24 from the transcriptome data.For studying its function,the relative expression levels of SbWRKY24 in roots and leaves post-treatment with different growth hormones and exposure to a variety of abiotic stresses were detected by RT-qPCR.SbWRKY24 showed treatment-and tis-sue-specific expression patterns,indicating its unique role in stress tolerance.This study lays a theoretical basis for the functional exploration of SbWRKY24,elucidating the mechanism of copper resistance,and elaborating on the stress responses in sorghum.It also guides the exploration of the molecular mechanism of copper ions inducing intracellular signal transduction pathways.

Gene expression,transcription factor binding and histone modification predict leaf adaxial-abaxial polarity related genes

Leaf adaxial-abaxial(ad-abaxial)polarity is crucial for leaf morphology and function,but the genetic machinery governing this process remains unclear.To uncover critical genes involved in leaf ad-abaxial patterning,we applied a combination of in silico prediction using machine learning(ML)and experimental analysis.A Random Forest model was trained using genes known to influence ad-abaxial polarity as ground truth.Gene expression data from various tissues and conditions as well as promoter regulation data derived from transcription factor chromatin immunoprecipitation sequencing(ChIP-seq)was used as input,enabling the prediction of novel ad-abaxial polarity-related genes and additional transcription factors.Parallel to this,available and newly-obtained transcriptome data enabled us to identify genes differentially expressed across leaf ad-abaxial sides.Based on these analyses,we obtained a set of 111 novel genes which are involved in leaf ad-abaxial specialization.To explore implications for vegetable crop breeding,we examined the conservation of expression patterns between Arabidopsis and Brassica rapa using single-cell transcriptomics.The results demonstrated the utility of our computational approach for predicting candidate genes in crop species.Our findings expand the understanding of the genetic networks governing leaf ad-abaxial differentiation in agriculturally important vegetables,enhancing comprehension of natural variation impacting leaf morphology and development,with demonstrable breeding applications.

The Magnaporthe oryzae effector Avr-PikD suppresses rice immunity by inhibiting an LSD1-like transcriptional activator

Avirulence effectors(Avrs),encoded by plant pathogens,can be recognized by plants harboring the corresponding resistance proteins,thereby initiating effector-triggered immunity(ETI).In susceptible plants,however,Avrs can function as effectors,facilitating infection via effector-triggered susceptibility(ETS).Mechanisms of Avr-mediated ETS remain largely unexplored.Here we report that the Magnaporthe oryzae effector Avr-PikD enters rice cells via the canonical cytoplasmic secretion pathway and suppresses rice basal defense.Avr-PikD interacts with an LSD1-like transcriptional activator AKIP30 of rice,and AKIP30 is also a positive regulator of rice immunity,whereas Avr-PikD impedes its nuclear localization and suppresses its transcriptional activity.In summary,M.oryzae delivers Avr-PikD into rice cells to facilitate ETS by inhibiting AKIP30-mediated transcriptional regulation of immune response against M.oryzae.

Prognostic significance of oligodendrocyte transcription factor 2 expression in glioma patients:A systematic review and metaanalys

BACKGROUND Gliomas are the most common primary central nervous system neoplasm.Despite recent advances in the diagnosis and treatment of gliomas,patient prognosis remains dismal.Therefore,it is imperative to identify novel diagnostic biomarkers and therapeutic targets of glioma to effectively improve treatment outcomes.AIM To investigate the association between oligodendrocyte transcription factor 2(Olig2)expression and the outcomes of glioma patients.METHODS The PubMed,Embase,Cochrane Library,and China National Knowledge Infrastructure databases were searched for studies(published up to October 2023)that investigated the relationship between Olig2 expression and prognosis of glioma patients.The quality of the studies was assessed using the Newcastle Ottawa Scale.Data analyses were performed using Stata Version 12.0 software.RESULTS A total of 1205 glioma patients from six studies were included in the metaanalysis.High Olig2 expression was associated with better outcomes in glioma patients[hazard ratio(HR):0.81;95%(confidence interval)CI:0.51-1.27;P=0.000].Furthermore,the results of subgroup meta-analysis showed that high expression of Olig2 was associated with poor overall survival in European patients(HR:1.34;95%CI:0.79-2.27)and better prognosis in Asian patients(HR:0.43;95%CI:0.22-0.84).The sensitivity analysis showed that no single study had a significant effect on pooled HR,and there was also no indication of publication bias according to the Egger’s and Begger’s P value test or funnel plot test.CONCLUSION High Olig2 expression may have a positive impact on the prognosis of glioma patients,and should be investigated further as a prognostic biomarker and therapeutic target for glioma.

Wheat kinase TaSnRK2.4 forms a functional module with phosphatase TaPP2C01 and transcription factor TaABF2 to regulate drought response

SNF1-related protein kinase 2(SnRK2)family members are essential components of the plant abscisic acid(ABA)signaling pathway initiated by osmotic stress and triggering a drought stress response.This study characterized the molecular properties of TaSnRK2.4 and its function in mediating adaptation to drought in Triticum aestivum.Transcripts of TaSnRK2.4 were upregulated upon drought and ABA signaling and associated with drought-and ABA-responsive cis-elements ABRE and DRE,and MYB and MYC binding sites in the promoter as indicated by reporter GUS protein staining and activity driven by truncations of the promoter.Yeast two-hybrid,BiFC,and Co-IP assays indicated that TaSnRK2.4 protein interacts with TaPP2C01 and an ABF transcription factor(TF)TaABF2.The results suggested that TaSnRK2.4 forms a functional TaPP2C01-TaSnRK2.4-TaABF2 module with its upstream and downstream partners.Transgene analysis revealed that TaSnRK2.4 and TaABF2 positively regulate drought tolerance whereas TaPP2C01 acts negatively by modulating stomatal movement,osmotic adjustment,reactive oxygen species(ROS)homeostasis,and root morphology.Expression analysis,yeast one-hybrid,and transcriptional activation assays indicated that several osmotic stress-responsive genes,including TaSLAC1-4,TaP5CS3,TaSOD5,TaCAT1,and TaPIN4,are regulated by TaABF2.Transgene analysis verified their functions in positively regulating stomatal movement(TaSLAC1-4),proline accumulation(TaP5CS3),SOD activity(TaSOD5),CAT activity(TaCAT1),and root morphology(TaPIN4).There were high correlations between plant biomass and yield with module transcripts in a wheat variety panel cultivated under drought conditions in the field.Our findings provide insights into understanding plant drought response underlying the SnRK2 signaling pathway in common wheat.

Clinical and molecular significance of homologous recombination deficiency positive non-small cell lung cancer in Chinese population:An integrated genomic and transcriptional analysis

Objective:The clinical significance of homologous recombination deficiency(HRD)in breast cancer,ovarian cancer,and prostate cancer has been established,but the value of HRD in non-small cell lung cancer(NSCLC)has not been fully investigated.This study aimed to systematically analyze the HRD status of untreated NSCLC and its relationship with patient prognosis to further guide clinical care.Methods:A total of 355 treatment-naïve NSCLC patients were retrospectively enrolled.HRD status was assessed using the AmoyDx Genomic Scar Score(GSS),with a score of≥50 considered HRD-positive.Genomic,transcriptomic,tumor microenvironmental characteristics and prognosis between HRD-positive and HRDnegative patients were analyzed.Results:Of the patients,25.1%(89/355)were HRD-positive.Compared to HRD-negative patients,HRDpositive patients had more somatic pathogenic homologous recombination repair(HRR)mutations,higher tumor mutation burden(TMB)(P<0.001),and fewer driver gene mutations(P<0.001).Furthermore,HRD-positive NSCLC had more amplifications in PI3K pathway and cell cycle genes,MET and MYC in epidermal growth factor receptor(EGFR)/anaplastic lymphoma kinase(ALK)mutant NSCLC,and more PIK3CA and AURKA in EGFR/ALK wild-type NSCLC.HRD-positive NSCLC displayed higher tumor proliferation and immunosuppression activity.HRD-negative NSCLC showed activated signatures of major histocompatibility complex(MHC)-II,interferon(IFN)-γand effector memory CD8+T cells.HRD-positive patients had a worse prognosis and shorter progressionfree survival(PFS)to targeted therapy(first-and third-generation EGFR-TKIs)(P=0.042).Additionally,HRDpositive,EGFR/ALK wild-type patients showed a numerically lower response to platinum-free immunotherapy regimens.Conclusions:Unique genomic and transcriptional characteristics were found in HRD-positive NSCLC.Poor prognosis and poor response to EGFR-TKIs and immunotherapy were observed in HRD-positive NSCLC.This study highlights potential actionable alterations in HRD-positive NSCLC,suggesting possible combinational therapeutic strategies for these patients.

A Study of English Translation Strategies of Subtitles of the Domestic Animated Film Chang’an from the Perspective of Eco-translatology

This article conducts an analysis and exploration of the English subtitles translation of the domestic animated film Chang’an from the perspective of eco-translatology.Taking three-dimensional transformation as the entry point,it analyzes the adaptation and selection of subtitle translators in the translation process from the dimensions of language,culture,and communication in Chang’an,aiming to enrich the practical analysis of eco-translatology and provide valuable insights and references for the theoretical construction and practical application of eco-translatology.This article enriches the practical analysis of eco-translatology and also validates to a certain extent the applicability of“three-dimensional”transformation.

High-throughput screening system of citrus bacterial cankerassociated transcription factors and its application to the regulation of citrus canker resistance

One of the main diseases that adversely impacts the global citrus industry is citrus bacterial canker(CBC),caused by the bacteria Xanthomonas citri subsp.citri(Xcc).Response to CBC is a complex process,with both proteinDNA as well as protein–protein interactions for the regulatory network.To detect such interactions in CBC resistant regulation,a citrus high-throughput screening system with 203 CBC-inducible transcription factors(TFs),were developed.Screening the upstream regulators of target by yeast-one hybrid(Y1H)methods was also performed.A regulatory module of CBC resistance was identified based on this system.One TF(CsDOF5.8)was explored due to its interactions with the 1-kb promoter fragment of CsPrx25,a resistant gene of CBC involved in reactive oxygen species(ROS)homeostasis regulation.Electrophoretic mobility shift assay(EMSA),dual-LUC assays,as well as transient overexpression of CsDOF5.8,further validated the interactions and transcriptional regulation.The CsDOF5.8–CsPrx25 promoter interaction revealed a complex pathway that governs the regulation of CBC resistance via H2O2homeostasis.The high-throughput Y1H/Y2H screening system could be an efficient tool for studying regulatory pathways or network of CBC resistance regulation.In addition,it could highlight the potential of these candidate genes as targets for efforts to breed CBC-resistant citrus varieties.

A Case Study of Periodical Terminologies’Mis-translations in History of Chinese Journalism by Ko Kung-chen under Analysis-Synthesis Translation Mode

From the perspective of analysis-synthesis translation mode,this paper discusses the translator’s responsibility and the translator’s role in the translation of historiography,based on the case of Ko Kung-chen’s History of Chinese Journalism.Missionary J.S.Roberts believed that translation is the logical combination of two processes of analysis and synthesis.The analysis process is characterized by understanding,emphasizing accurate understanding and professional analysis of the source text,while the synthesis process focuses on the transformation of language and culture.The two processes are dependent,forming the whole process of translation altogether.As the indisputable subject of translation,the translator should assume his own subjective responsibility in the two processes.The translator should be responsible for the fact and professional academics in the analysis process,and language and culture and translation itself in the synthesis process,playing the role of a reviewer,disseminator and translator to ensure that the translation text would be correct,accurate and professional so as to realize the value of himself and translation.